ID: 1040662936

View in Genome Browser
Species Human (GRCh38)
Location 8:49596578-49596600
Sequence CCTTATACAAAGGAGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040662927_1040662936 23 Left 1040662927 8:49596532-49596554 CCTCATGTGCACTGGAAGGGTGG No data
Right 1040662936 8:49596578-49596600 CCTTATACAAAGGAGGAGCCTGG No data
1040662926_1040662936 24 Left 1040662926 8:49596531-49596553 CCCTCATGTGCACTGGAAGGGTG No data
Right 1040662936 8:49596578-49596600 CCTTATACAAAGGAGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040662936 Original CRISPR CCTTATACAAAGGAGGAGCC TGG Intergenic
No off target data available for this crispr