ID: 1040666116

View in Genome Browser
Species Human (GRCh38)
Location 8:49635513-49635535
Sequence AAGGATCCTGCATATCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040666111_1040666116 3 Left 1040666111 8:49635487-49635509 CCAGTGCTTTGTTTTTGAGACAG No data
Right 1040666116 8:49635513-49635535 AAGGATCCTGCATATCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040666116 Original CRISPR AAGGATCCTGCATATCTTGG GGG Intergenic
No off target data available for this crispr