ID: 1040679262

View in Genome Browser
Species Human (GRCh38)
Location 8:49789031-49789053
Sequence TGAATTATCAAGGACTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040679257_1040679262 8 Left 1040679257 8:49789000-49789022 CCAATTTATGGTTTGTAGCAAAT No data
Right 1040679262 8:49789031-49789053 TGAATTATCAAGGACTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040679262 Original CRISPR TGAATTATCAAGGACTTGGA AGG Intergenic
No off target data available for this crispr