ID: 1040683440

View in Genome Browser
Species Human (GRCh38)
Location 8:49841910-49841932
Sequence AATTCTAGGTAGACAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040683437_1040683440 3 Left 1040683437 8:49841884-49841906 CCTATGATAGCAACAGGAGACAG No data
Right 1040683440 8:49841910-49841932 AATTCTAGGTAGACAGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040683440 Original CRISPR AATTCTAGGTAGACAGTGGC AGG Intergenic
No off target data available for this crispr