ID: 1040683521

View in Genome Browser
Species Human (GRCh38)
Location 8:49842535-49842557
Sequence CCTTGCGGCAGCAACTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040683521_1040683533 24 Left 1040683521 8:49842535-49842557 CCCCCCAAGTTGCTGCCGCAAGG No data
Right 1040683533 8:49842582-49842604 GCACCCAGAAGTTCTCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040683521 Original CRISPR CCTTGCGGCAGCAACTTGGG GGG (reversed) Intergenic
No off target data available for this crispr