ID: 1040683526

View in Genome Browser
Species Human (GRCh38)
Location 8:49842539-49842561
Sequence TGGGCCTTGCGGCAGCAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040683526_1040683533 20 Left 1040683526 8:49842539-49842561 CCAAGTTGCTGCCGCAAGGCCCA No data
Right 1040683533 8:49842582-49842604 GCACCCAGAAGTTCTCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040683526 Original CRISPR TGGGCCTTGCGGCAGCAACT TGG (reversed) Intergenic