ID: 1040683533

View in Genome Browser
Species Human (GRCh38)
Location 8:49842582-49842604
Sequence GCACCCAGAAGTTCTCGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040683528_1040683533 9 Left 1040683528 8:49842550-49842572 CCGCAAGGCCCACACGGAGTTTG No data
Right 1040683533 8:49842582-49842604 GCACCCAGAAGTTCTCGCCCTGG No data
1040683521_1040683533 24 Left 1040683521 8:49842535-49842557 CCCCCCAAGTTGCTGCCGCAAGG No data
Right 1040683533 8:49842582-49842604 GCACCCAGAAGTTCTCGCCCTGG No data
1040683524_1040683533 22 Left 1040683524 8:49842537-49842559 CCCCAAGTTGCTGCCGCAAGGCC No data
Right 1040683533 8:49842582-49842604 GCACCCAGAAGTTCTCGCCCTGG No data
1040683523_1040683533 23 Left 1040683523 8:49842536-49842558 CCCCCAAGTTGCTGCCGCAAGGC No data
Right 1040683533 8:49842582-49842604 GCACCCAGAAGTTCTCGCCCTGG No data
1040683526_1040683533 20 Left 1040683526 8:49842539-49842561 CCAAGTTGCTGCCGCAAGGCCCA No data
Right 1040683533 8:49842582-49842604 GCACCCAGAAGTTCTCGCCCTGG No data
1040683530_1040683533 0 Left 1040683530 8:49842559-49842581 CCACACGGAGTTTGCTCCTACCA No data
Right 1040683533 8:49842582-49842604 GCACCCAGAAGTTCTCGCCCTGG No data
1040683525_1040683533 21 Left 1040683525 8:49842538-49842560 CCCAAGTTGCTGCCGCAAGGCCC No data
Right 1040683533 8:49842582-49842604 GCACCCAGAAGTTCTCGCCCTGG No data
1040683529_1040683533 1 Left 1040683529 8:49842558-49842580 CCCACACGGAGTTTGCTCCTACC No data
Right 1040683533 8:49842582-49842604 GCACCCAGAAGTTCTCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040683533 Original CRISPR GCACCCAGAAGTTCTCGCCC TGG Intergenic