ID: 1040683873

View in Genome Browser
Species Human (GRCh38)
Location 8:49847053-49847075
Sequence TTCAAGAAGCTGAAATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040683873_1040683875 -5 Left 1040683873 8:49847053-49847075 CCTTCCTATTTCAGCTTCTTGAA No data
Right 1040683875 8:49847071-49847093 TTGAAACTATGAGACTCCTGAGG No data
1040683873_1040683880 29 Left 1040683873 8:49847053-49847075 CCTTCCTATTTCAGCTTCTTGAA No data
Right 1040683880 8:49847105-49847127 AAGTAGAGATGGTAACAGGATGG No data
1040683873_1040683879 25 Left 1040683873 8:49847053-49847075 CCTTCCTATTTCAGCTTCTTGAA No data
Right 1040683879 8:49847101-49847123 CCTAAAGTAGAGATGGTAACAGG No data
1040683873_1040683881 30 Left 1040683873 8:49847053-49847075 CCTTCCTATTTCAGCTTCTTGAA No data
Right 1040683881 8:49847106-49847128 AGTAGAGATGGTAACAGGATGGG No data
1040683873_1040683877 18 Left 1040683873 8:49847053-49847075 CCTTCCTATTTCAGCTTCTTGAA No data
Right 1040683877 8:49847094-49847116 AGATTATCCTAAAGTAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040683873 Original CRISPR TTCAAGAAGCTGAAATAGGA AGG (reversed) Intergenic
No off target data available for this crispr