ID: 1040685385

View in Genome Browser
Species Human (GRCh38)
Location 8:49865498-49865520
Sequence GCTAGGCAATGGCCACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040685385_1040685390 24 Left 1040685385 8:49865498-49865520 CCTGGCTGTGGCCATTGCCTAGC No data
Right 1040685390 8:49865545-49865567 CTCAAGCATCTCTCCATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040685385 Original CRISPR GCTAGGCAATGGCCACAGCC AGG (reversed) Intergenic
No off target data available for this crispr