ID: 1040685390

View in Genome Browser
Species Human (GRCh38)
Location 8:49865545-49865567
Sequence CTCAAGCATCTCTCCATGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040685387_1040685390 7 Left 1040685387 8:49865515-49865537 CCTAGCTCTCTTGTGTCCTCCAT No data
Right 1040685390 8:49865545-49865567 CTCAAGCATCTCTCCATGTTTGG No data
1040685385_1040685390 24 Left 1040685385 8:49865498-49865520 CCTGGCTGTGGCCATTGCCTAGC No data
Right 1040685390 8:49865545-49865567 CTCAAGCATCTCTCCATGTTTGG No data
1040685388_1040685390 -9 Left 1040685388 8:49865531-49865553 CCTCCATCATACATCTCAAGCAT No data
Right 1040685390 8:49865545-49865567 CTCAAGCATCTCTCCATGTTTGG No data
1040685386_1040685390 13 Left 1040685386 8:49865509-49865531 CCATTGCCTAGCTCTCTTGTGTC No data
Right 1040685390 8:49865545-49865567 CTCAAGCATCTCTCCATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040685390 Original CRISPR CTCAAGCATCTCTCCATGTT TGG Intergenic
No off target data available for this crispr