ID: 1040690082

View in Genome Browser
Species Human (GRCh38)
Location 8:49926906-49926928
Sequence TTACCGATTTTTTAATTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 293}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040690082_1040690086 16 Left 1040690082 8:49926906-49926928 CCAACCAATTAAAAAATCGGTAA 0: 1
1: 0
2: 1
3: 22
4: 293
Right 1040690086 8:49926945-49926967 TCTCACCAAAGAAGACATGCAGG No data
1040690082_1040690087 19 Left 1040690082 8:49926906-49926928 CCAACCAATTAAAAAATCGGTAA 0: 1
1: 0
2: 1
3: 22
4: 293
Right 1040690087 8:49926948-49926970 CACCAAAGAAGACATGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040690082 Original CRISPR TTACCGATTTTTTAATTGGT TGG (reversed) Intronic
900012364 1:127685-127707 TTACAGATTTTATAATTTGGGGG - Intergenic
900042423 1:483669-483691 TTACAGATTTTATAATTTGGGGG - Intergenic
900063862 1:718662-718684 TTACAGATTTTATAATTTGGGGG - Intergenic
901299919 1:8192192-8192214 TTACCTATTTTCTACTTGGACGG + Intergenic
902133430 1:14283407-14283429 TTCCCCATTTTTTAATTGGGTGG - Intergenic
903421186 1:23218498-23218520 TTACCGGTTTTTTGGTTGGTTGG + Intergenic
905728275 1:40274337-40274359 TTACATATTTGTAAATTGGTAGG + Intronic
908967636 1:69785758-69785780 TTTCAGATTTTTTCATTGTTTGG - Intronic
911744418 1:101424416-101424438 TTATCCATTCTATAATTGGTGGG + Intergenic
912196730 1:107406178-107406200 TTTCCTATTTTTTAGTGGGTAGG - Intronic
913933787 1:125012893-125012915 TCACCCATTTTTTGATGGGTTGG - Intergenic
914933733 1:151959766-151959788 TTACTATTTTTTTAACTGGTGGG - Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916276175 1:162996149-162996171 TTGCCCATTTTTTAATAGGGTGG - Intergenic
916911445 1:169351803-169351825 TTACAGATTTTTAAATTTATTGG - Intronic
917238240 1:172917810-172917832 TGACCTATTTTTCAGTTGGTAGG + Intergenic
919015283 1:192025576-192025598 TTGCCCACTTTTTAATGGGTGGG + Intergenic
919402500 1:197137415-197137437 TTACAGATTTTATAATTTGGGGG - Intronic
920867338 1:209763838-209763860 ATTCCCATTTTTTAATTTGTTGG + Intronic
921257742 1:213357503-213357525 ATACAGACTTTTTATTTGGTGGG + Intergenic
921489641 1:215759052-215759074 TTCCCCATTTTTAAATAGGTTGG + Intronic
921496142 1:215844180-215844202 TTACAGATTATTTCTTTGGTGGG - Intronic
922260795 1:223944153-223944175 TTACAGATTTTATAATTTGGGGG - Intergenic
922475115 1:225901600-225901622 TTGCCCATTTCTTAATTGGGTGG - Intronic
922736274 1:227981578-227981600 TTACAGATTTTATAATTTGGGGG + Intergenic
924265268 1:242275396-242275418 TTACTGAATTTTTAGTTTGTAGG + Intronic
924341971 1:243046339-243046361 TTACAGATTTTATAATTTGGGGG - Intergenic
924827356 1:247553896-247553918 TTACCTATCTTTTAATTTCTGGG + Intronic
1064388181 10:14917828-14917850 TTACTCATTTTTAAATTGTTGGG - Intronic
1064452419 10:15454507-15454529 TCAGAGATTTTTTATTTGGTTGG + Intergenic
1066719553 10:38323094-38323116 TTACTGAATTTTTAGTTTGTAGG - Intergenic
1066734511 10:38459200-38459222 TTACAGATTTTATAATTTGGGGG + Intergenic
1068290333 10:54993870-54993892 TTTCTGACTTTTTAATTTGTTGG - Intronic
1068853213 10:61768714-61768736 TTACACATTTAATAATTGGTGGG + Intergenic
1069210790 10:65757643-65757665 TTACTTTTTTTTTAATTTGTTGG + Intergenic
1072382286 10:94886784-94886806 TTAGAGATTTTTTAATTTGGGGG + Intergenic
1073174051 10:101539962-101539984 TTTCCCATTTTTTAATTGAGTGG + Intronic
1073997948 10:109337912-109337934 TTCCCTCTTTTTTTATTGGTTGG + Intergenic
1074706216 10:116134347-116134369 TTACCCATTTTTTAATTTTCTGG - Intronic
1076968694 11:119889-119911 TTACAGATTTTATAATTTGGGGG - Intergenic
1078411908 11:11129751-11129773 TTACAGTTTTTTTAATTTGAGGG + Intergenic
1080147935 11:29010507-29010529 ATACATATTTTTTAATTGGATGG - Intergenic
1085059655 11:73433209-73433231 TTTCCCATTTTTTCATTGGGTGG + Intronic
1085087487 11:73680203-73680225 TTCCTGTTTTTTTAACTGGTGGG + Intronic
1085729622 11:78985622-78985644 TTATCTATTTATTGATTGGTAGG + Intronic
1086308270 11:85505752-85505774 TTCCCGCTTTTTCAATTGATTGG + Intronic
1087737179 11:101847745-101847767 TCTACGATTTTTTAATTAGTTGG + Intronic
1087954041 11:104261768-104261790 TTGCCCATTTTTTAATTAGGTGG + Intergenic
1090171271 11:124607152-124607174 TTTCCTTTTTTTTTATTGGTAGG - Intergenic
1091528957 12:1335868-1335890 TTACTGTTTATTTATTTGGTTGG + Intronic
1091888519 12:4033751-4033773 TTCCCTATTTCTGAATTGGTAGG - Intergenic
1092948647 12:13480012-13480034 TTACAGATTTTTTAAATGAAAGG - Intergenic
1093329970 12:17824227-17824249 TTCCCTCTTTTTTTATTGGTTGG - Intergenic
1093728284 12:22540919-22540941 GTACTGATTTTTTAATTGTAAGG + Intronic
1094627992 12:32143558-32143580 TTATCCATTTTTTAGTTGATGGG + Intronic
1094699462 12:32854789-32854811 TTACTTATTTTATAATTGGCAGG - Intronic
1098696534 12:73564494-73564516 TTATCCATTTTTTATTTGATGGG - Intergenic
1098933821 12:76453695-76453717 TTACTGATTTTTTAATTTTTGGG - Intronic
1099351115 12:81569835-81569857 TTACTGATTTTTTTATAGATAGG + Intronic
1100557113 12:95706455-95706477 TTACTGATTTTTAAATTGTTTGG - Intronic
1101796141 12:107975931-107975953 TTACTGATTGATTAATTGATTGG - Intergenic
1102688218 12:114740716-114740738 GTACAGATTATTTAATTGCTCGG + Intergenic
1104612213 12:130238105-130238127 TTGCCCATTTTTTAATAGGGTGG - Intergenic
1105662870 13:22518258-22518280 TTAGCTATTATTTAATTTGTAGG - Intergenic
1108306121 13:49135197-49135219 TCACCCATTTTTTAAATGGGTGG + Intronic
1108563542 13:51671100-51671122 TTATCCATTTGTTGATTGGTGGG + Intronic
1109071633 13:57776461-57776483 TTTCCGATTTTTTAAAATGTAGG + Intergenic
1109686291 13:65824075-65824097 TTACCAATCTTTTATTTTGTAGG + Intergenic
1111249316 13:85582833-85582855 TTATCCATTTATTAATTGATGGG + Intergenic
1112649427 13:101377056-101377078 TTACCCATCTTTTAATTTGTAGG - Exonic
1113006557 13:105709725-105709747 TTACCCATCTTTTAATAGGGTGG + Intergenic
1113529225 13:111008260-111008282 TTACAGATTTTTTAAATATTAGG + Intergenic
1114066861 14:19067650-19067672 TTACATATTTTTTAAAAGGTTGG + Intergenic
1114095404 14:19332377-19332399 TTACATATTTTTTAAAAGGTTGG - Intergenic
1114701655 14:24684760-24684782 TTACCAATTTTTTTATTAGTTGG + Intergenic
1116473867 14:45317569-45317591 TTACCTATTTTTTTTTTTGTGGG + Intergenic
1116644207 14:47505833-47505855 CTATTGATTTTTTACTTGGTTGG + Intronic
1116694597 14:48156704-48156726 TTCCCCATTTTTTTATTGATTGG + Intergenic
1117574444 14:57083934-57083956 TTACCCATTTTTTAAATGATTGG + Intergenic
1118624138 14:67641943-67641965 TTAACCATTTTTTTATTGTTGGG + Intronic
1118660686 14:68006692-68006714 TTACCCAATTTTTTATTGATAGG + Intronic
1118926452 14:70194378-70194400 TTACCTAGTTTATCATTGGTGGG + Intergenic
1119636985 14:76281276-76281298 TTGCCCATTTTTTAATTGAATGG - Intergenic
1120381737 14:83789395-83789417 TTAAAGATTTTTTAACTGGAAGG + Intergenic
1120537901 14:85719786-85719808 TTCCCTATTTGTTAATTCGTTGG + Intergenic
1120853658 14:89194013-89194035 TTACCCATTTTTTAGTTAGGTGG + Intronic
1121037350 14:90717429-90717451 TTACAGATTTCTTTATTGGTGGG + Intronic
1121402887 14:93696642-93696664 TTGCCCATTTTTTATTGGGTTGG + Intronic
1121430789 14:93886522-93886544 TTACCAATTTTTTCATTTGATGG + Intergenic
1122421532 14:101580707-101580729 TTGCCCACTTTTTAATGGGTTGG + Intergenic
1122603972 14:102935919-102935941 TTACCCATTTTTGAAATGGGTGG - Intronic
1122713910 14:103681751-103681773 TTTCTTATTTTTTAAATGGTAGG + Intronic
1126073902 15:44889871-44889893 TTTCCCATTTATTTATTGGTTGG - Intergenic
1128268930 15:66292212-66292234 TTACCCAGTTATTAAGTGGTGGG - Intergenic
1129259201 15:74354667-74354689 TTACCGGGTTTAAAATTGGTGGG - Intronic
1129595817 15:76963351-76963373 TTACTGTTTTTTTAATTATTAGG + Intergenic
1130700240 15:86171796-86171818 TTATCCATTTGTTGATTGGTGGG - Intronic
1137067348 16:35862309-35862331 TTAGTGTTTTTTTAATTGTTTGG - Intergenic
1137317601 16:47343520-47343542 TTACCTATTTTTTAACTGGGTGG - Intronic
1138163148 16:54775057-54775079 TTACCGATCTTTTCATTGCTGGG + Intergenic
1139771510 16:69280669-69280691 TTGCCCATTTTTTAACTGGGTGG + Intronic
1139869582 16:70095446-70095468 TTACTGATTTTTCAAATGATAGG - Intergenic
1140385804 16:74536774-74536796 TTACTGATTTTTCAAATGATAGG + Intronic
1142451981 16:90179233-90179255 TTACAGATTTTATAATTTGGGGG + Intergenic
1145848527 17:28066924-28066946 TTGCCCATATTTTAATTGGGTGG + Intronic
1146009622 17:29183146-29183168 TTACCCATTTCTAAATTGGGTGG - Intergenic
1146193849 17:30794371-30794393 TTACCCATTTTTCTATTGGGTGG - Intronic
1148260047 17:46174160-46174182 TTCCCAATATTTTATTTGGTGGG + Intronic
1149721885 17:58852946-58852968 TTGCCCACTTTTTAATTGGGTGG + Intronic
1150318537 17:64190222-64190244 TTAGCATTTTTTTAATTGCTAGG + Intronic
1150364118 17:64566109-64566131 TTAAAGATTTTTAAATTGGGGGG - Intronic
1150673083 17:67219279-67219301 CAACCAGTTTTTTAATTGGTGGG - Intronic
1151779185 17:76231299-76231321 TTGCACATTTTTTAATTGGGTGG + Intronic
1151779374 17:76233222-76233244 TTGCACATTTTTTAATTGGATGG + Intronic
1153373639 18:4350809-4350831 TTACCAATTTTTCAAATAGTAGG + Intronic
1153728159 18:7979379-7979401 TTACCGATAGGTTCATTGGTTGG + Intronic
1156864821 18:41877008-41877030 TTACCTTTTTTTTGTTTGGTTGG + Intergenic
1157390973 18:47303119-47303141 TTACAGATTGATTAATTGGCTGG + Intergenic
1159290721 18:66415312-66415334 TTAACCAGTCTTTAATTGGTGGG - Intergenic
1159543323 18:69808851-69808873 TTCCCTATTTTTTAAATGTTTGG - Intronic
1160645503 19:189816-189838 TTACAGATTTTATAATTTGGGGG - Intergenic
1161121471 19:2529185-2529207 TTACCCATTTTTGTGTTGGTGGG + Intronic
1161661454 19:5549144-5549166 TTACCGGATTTGAAATTGGTGGG - Intergenic
1162619222 19:11827364-11827386 TTGCTTATTTTTTGATTGGTTGG + Intronic
1162627947 19:11900653-11900675 TTGCTTATTTTTTGATTGGTTGG + Intronic
925815696 2:7746162-7746184 TTACTTATTTTTTTATTGTTTGG - Intergenic
926043844 2:9695172-9695194 TTACTGATTTTTTTGTTGTTTGG + Intergenic
926543894 2:14214485-14214507 TCAGCTATTTTTTAGTTGGTTGG - Intergenic
927046558 2:19284951-19284973 TTGCCCACTTTTTAATGGGTGGG - Intergenic
928041239 2:27879851-27879873 TGGCCTATTTTTTAGTTGGTAGG - Intronic
929166437 2:38886637-38886659 TTAAGGTTTTTTTAATTGTTGGG - Intronic
929415790 2:41745940-41745962 GTACCAATTTTTTATTTGTTAGG + Intergenic
929469062 2:42172810-42172832 TTACCGATTTTTTATAAGGCAGG + Intronic
931015460 2:57974334-57974356 TTACCAATATTTTAATCTGTTGG - Intronic
932540455 2:72646409-72646431 TTCCCTCTTTTTTTATTGGTTGG - Intronic
933318113 2:80739010-80739032 TTGCCAGTCTTTTAATTGGTGGG - Intergenic
933802174 2:85970298-85970320 TTACCAATTTTTTTTTTTGTAGG - Intergenic
936225645 2:110647718-110647740 TTGTCCATTTTCTAATTGGTTGG - Intronic
937811945 2:126209344-126209366 TTACCTATTTTTTATAAGGTGGG - Intergenic
938484257 2:131687741-131687763 TTACGTATTTTTTAAAAGGTTGG + Intergenic
939580399 2:143939654-143939676 TTACAGAATTCTTAATGGGTGGG - Exonic
939865786 2:147470979-147471001 TTACTGATTTCTTAATTGCTAGG - Intergenic
939946522 2:148417785-148417807 TTGCCCACTTTTTAATGGGTTGG + Intronic
940503438 2:154523540-154523562 TTCCAGATTTTTCAATTTGTTGG + Intergenic
940947078 2:159629975-159629997 TTACCTATTTTTTAACTGAAAGG + Intergenic
941593500 2:167448009-167448031 TTATCCACTTTTTGATTGGTGGG + Intergenic
942678956 2:178456792-178456814 TTACACATTTTTTTTTTGGTTGG - Intronic
942702462 2:178729245-178729267 TTACAGAATTTTTATTTGATAGG + Intronic
943626311 2:190204986-190205008 TTTCCGCATTTTTAAATGGTTGG - Exonic
945388272 2:209230465-209230487 TTCCCCCTTTTTTAATTGTTTGG + Intergenic
945466684 2:210177576-210177598 TTACCACTTTTTTATTTTGTGGG - Intergenic
946436151 2:219656386-219656408 TTGCCCATTTTTTAAGTGGATGG - Intergenic
947456582 2:230259827-230259849 TTATCCACTTGTTAATTGGTGGG + Intronic
949083407 2:242123794-242123816 TTACAGATTTTATAATTTGGGGG + Intergenic
1171055972 20:21906885-21906907 TTGCCCATTTTTAAATTGGGTGG + Intergenic
1172651380 20:36504823-36504845 TCGCCCATTTTTTAATTGGGTGG + Intronic
1172955549 20:38755596-38755618 TTACCCTTTTTTTTTTTGGTGGG - Intronic
1173296067 20:41758919-41758941 TTACTTATTTTTTAAATGTTTGG + Intergenic
1173447685 20:43134728-43134750 CTACCTATTTTCTAATTGGGAGG + Intronic
1176280000 20:64296415-64296437 TTACAGATTTTATAATTTGGGGG + Intergenic
1177324738 21:19570172-19570194 TTGTCCATTTTTTAATTGGATGG - Intergenic
1177741738 21:25162600-25162622 TCACCCATTTTTTAAATAGTTGG - Intergenic
1178033368 21:28554241-28554263 ATAATCATTTTTTAATTGGTGGG - Intergenic
1179305224 21:40147834-40147856 TTAACCTTTTTTTAATTGTTGGG + Intronic
1180485344 22:15790234-15790256 TTACATATTTTTTAAAAGGTTGG + Intergenic
1180753141 22:18139797-18139819 TTAGCCATTTTTTTAATGGTAGG + Intronic
1181718915 22:24758394-24758416 TTATAGATTTTTTAAATGATTGG - Intronic
1182402728 22:30093898-30093920 TTAATTATTTTTTAATAGGTTGG + Exonic
1183815292 22:40294968-40294990 AAACAGATTTTTAAATTGGTTGG + Intronic
1184250396 22:43256905-43256927 TTAATTCTTTTTTAATTGGTTGG + Intronic
949658742 3:6252583-6252605 TTACCAATTTTTTTATTAGTCGG - Intergenic
950555092 3:13690554-13690576 TTACCAGTTTTTGTATTGGTTGG - Intergenic
950836262 3:15922275-15922297 GCACCTATTATTTAATTGGTTGG - Intergenic
950970801 3:17185368-17185390 TTACCCTTTTTTTATTTTGTTGG - Intronic
951277554 3:20707263-20707285 TTACCCATTCATTAATTGATAGG + Intergenic
952394358 3:32908140-32908162 CTACTAATTTTTTAATTTGTTGG + Intergenic
952661053 3:35847651-35847673 TTAGCTATTTTCTTATTGGTTGG + Intergenic
953851142 3:46466241-46466263 TTACCCTTTTTTTTTTTGGTGGG - Intronic
958845508 3:99260333-99260355 TGACCTATTTTGTAAGTGGTAGG - Intergenic
959787042 3:110312263-110312285 TTAATTTTTTTTTAATTGGTAGG - Intergenic
962969230 3:140383503-140383525 TTACCTATGTTTTTATTGATTGG - Intronic
963101753 3:141613706-141613728 TTGCCAATTTTGTTATTGGTGGG + Exonic
965198440 3:165627886-165627908 TGAGTGATATTTTAATTGGTTGG + Intergenic
965213291 3:165824638-165824660 TTATCAATTTTTTAATTTGGGGG - Intronic
966384750 3:179384476-179384498 TTACCTATTTTTAAATTATTTGG + Intronic
967049185 3:185766423-185766445 TTTCCCTTTTTTTAAATGGTTGG + Intronic
967567070 3:190985836-190985858 TTGCCCATTTTTTAATGGGGTGG + Intergenic
967879666 3:194292409-194292431 TTTCAGATTTTTTAATGGGCTGG + Intergenic
968372179 3:198229710-198229732 TTACAGATTTTATAATTTGGGGG + Intergenic
970188441 4:13486246-13486268 TTTCCTTTTTTTTAAATGGTGGG - Intergenic
970990490 4:22207901-22207923 TTCCCTATTTTTTTATTGATTGG - Intergenic
971221213 4:24708039-24708061 TTATCGATTTTTTATTTTATGGG + Intergenic
972546675 4:40086629-40086651 TTAAATATTTTTTATTTGGTCGG - Intronic
973129563 4:46633883-46633905 TTCCATTTTTTTTAATTGGTGGG + Intergenic
973336630 4:48962971-48962993 TTACCCATATTTTAATTACTTGG - Intergenic
973627423 4:52786917-52786939 TTCCTGATTTTTTATTTGTTTGG - Intergenic
974773344 4:66445463-66445485 GTTCCCATTTCTTAATTGGTTGG + Intergenic
975618988 4:76276646-76276668 TTACCATTTTTTAAATTGGATGG + Intronic
975939017 4:79617984-79618006 TAACTATTTTTTTAATTGGTTGG + Intergenic
976305071 4:83551940-83551962 CTACTGATGTTTTATTTGGTTGG - Intronic
977380386 4:96265856-96265878 TTGCCAATTTTTTGATTGATAGG + Intergenic
977773234 4:100884359-100884381 TTACCAATGTTTTCTTTGGTTGG + Intergenic
977863354 4:101993865-101993887 TTACCAATTTTATATTTGCTTGG + Intronic
978984715 4:114997459-114997481 TTATCACTGTTTTAATTGGTTGG + Intronic
979010444 4:115360934-115360956 TCTCTGATTTTTTAATTTGTTGG - Intergenic
979260862 4:118642190-118642212 TTACAGATTTTATAATTTGGGGG + Intergenic
979840050 4:125427238-125427260 TTAACGATTTTTTAAGTGTATGG + Intronic
981805194 4:148707210-148707232 TTACTAATTTTTTTTTTGGTGGG + Intergenic
982850706 4:160311895-160311917 TTGCCCACTTTTTAATGGGTTGG + Intergenic
982979153 4:162108958-162108980 TTACGTATTTTTTAGTTTGTTGG - Intronic
983015092 4:162603607-162603629 TTACTTCTTTTTTAAGTGGTAGG - Intergenic
983375279 4:166919392-166919414 TAAATGATTTTTTAAGTGGTGGG + Intronic
983978450 4:173965464-173965486 TTCCCTCTTTTTGAATTGGTTGG + Intergenic
986669703 5:10132004-10132026 TTATCCATTTGTTGATTGGTGGG - Intergenic
987432040 5:17846335-17846357 TTAGCATTTTTTTAAATGGTGGG + Intergenic
987537932 5:19212050-19212072 TTAGCTCTTTTTTAAGTGGTTGG - Intergenic
987631775 5:20482166-20482188 TTCTAGATTTTTTAGTTGGTTGG - Intronic
989164767 5:38423443-38423465 TTAACCATTTTTTAAGAGGTGGG - Intronic
991008435 5:61855455-61855477 TTAGAGATTTTTTAATTGAGGGG - Intergenic
991552580 5:67857045-67857067 CTGCAGATTTTATAATTGGTTGG + Intergenic
992813222 5:80409821-80409843 TTAACCATTTTTGGATTGGTGGG + Intronic
993029013 5:82682050-82682072 TTATCCATTCTTTCATTGGTGGG + Intergenic
993418548 5:87669357-87669379 TTGCCTAATTTTTAATTGGATGG - Intergenic
993829126 5:92731578-92731600 TTTCCAATTTTTTAAATGTTGGG + Intergenic
993866164 5:93198839-93198861 TTATCGATTTTTTAATTTTATGG - Intergenic
994538491 5:101061661-101061683 TTATCAATTCATTAATTGGTGGG + Intergenic
995655273 5:114419260-114419282 TTTCACATTTTTTAATTGTTTGG + Intronic
995727195 5:115193695-115193717 TTACCCATTTTTTAATTTCTAGG - Intergenic
995839828 5:116433117-116433139 TCACCGAGTTAGTAATTGGTGGG - Intergenic
995895242 5:117003740-117003762 TTACCCATTTGTTGATTGATGGG + Intergenic
996244694 5:121247275-121247297 TTAGTTATGTTTTAATTGGTGGG - Intergenic
997019168 5:129976666-129976688 TTATATATTTTTTAAATGGTGGG + Intronic
997048095 5:130344348-130344370 TTGCCCATTTTTAAATTGGGTGG + Intergenic
999525317 5:152399114-152399136 TTACACATTTTTTAATTTGTGGG + Intronic
999879832 5:155850035-155850057 TTGCTGTTTGTTTAATTGGTTGG + Intergenic
1000590742 5:163154399-163154421 TTCAGGATCTTTTAATTGGTGGG - Intergenic
1002731420 5:181335260-181335282 TTACAGATTTTATAATTTGGGGG + Intergenic
1002753119 6:138830-138852 TTACAGATTTTATAATTTGGGGG - Intergenic
1002870602 6:1164149-1164171 TTACCAATTTTTTTGCTGGTGGG - Intergenic
1003169092 6:3706707-3706729 TTGCCCATTTTTGAATTGGGTGG - Intergenic
1003402665 6:5803662-5803684 TTACTGATTCTTTATTTTGTAGG - Intergenic
1006731946 6:36242910-36242932 TTACCTGTTTTTTTTTTGGTTGG - Intergenic
1007380056 6:41483765-41483787 TTATCGATTTGTTTGTTGGTTGG - Intergenic
1007536420 6:42594505-42594527 ATTCTGATTTTTTATTTGGTTGG + Intronic
1008073722 6:47123799-47123821 TTAGCCATTTTTTAATTGGGTGG + Intergenic
1009678264 6:66856293-66856315 TTACCTGTTTTTTAGTTTGTTGG + Intergenic
1011139559 6:84137550-84137572 TTACAGATTTTTTCATTTGTGGG - Intronic
1012392267 6:98755880-98755902 AGACTGATTTTTTAATTGCTTGG - Intergenic
1012614271 6:101257147-101257169 TTTGAAATTTTTTAATTGGTTGG - Intergenic
1013197100 6:107854102-107854124 TTACCCATTTTTTAATCAGGTGG + Intergenic
1013608301 6:111771414-111771436 TCTTGGATTTTTTAATTGGTAGG - Intronic
1014267299 6:119294682-119294704 ATTCTGATTTTTTTATTGGTTGG - Intronic
1015584734 6:134763817-134763839 TTACCCATTTTGTTATTGATGGG + Intergenic
1015784784 6:136911376-136911398 TTACCGATTCTTTTGTTAGTGGG + Intronic
1016472849 6:144392938-144392960 TTACAAATTTTTTAAATGGCTGG + Intronic
1016792988 6:148086012-148086034 TTACACTTTTTTTAAATGGTTGG + Intergenic
1018162514 6:161060008-161060030 TTCAGGATTTTTTAATTGGTTGG + Intronic
1018749152 6:166787994-166788016 TTGCCGACTTTTTGATGGGTTGG - Intronic
1019646645 7:2133371-2133393 TCACCCATTTTTTAATTGGGTGG + Intronic
1020957502 7:14760082-14760104 TTGACCATTTTTTAATTGGACGG + Intronic
1021153887 7:17185748-17185770 TGACCTATTTTTTATTTTGTTGG - Intergenic
1021257343 7:18409183-18409205 TTACCTACTTGTTAATTGGCAGG + Intronic
1021978950 7:26036069-26036091 TTAGGGGTTTTTTAATTGTTTGG + Intergenic
1022743312 7:33143907-33143929 TTGCCCATTTTTTAATGGGATGG + Intronic
1024076568 7:45822436-45822458 TTACAGATTTTATAATTTGGGGG + Intergenic
1025059629 7:55794586-55794608 TTACAGATTTTATAATTTGGGGG - Exonic
1025127849 7:56358992-56359014 TTACAGATTTTATAATTTGGGGG - Intergenic
1027212354 7:76160763-76160785 TTAACGATTTATTGGTTGGTTGG - Intergenic
1027823629 7:83081291-83081313 ATACAGATTTTATAATTAGTGGG + Intronic
1028531472 7:91842890-91842912 TTCCCTATTTTTTAATTGCTGGG + Intronic
1028565822 7:92229457-92229479 TTACCCACTTTTTAATGGGGTGG - Intronic
1028626784 7:92886839-92886861 GTCCCGCTTTTTTAATTGTTTGG + Intergenic
1030098011 7:105918535-105918557 TTGCCCATTTTTTAATTGGGTGG + Intronic
1030668200 7:112305463-112305485 ATACTGATTGTTTAATTTGTTGG + Intronic
1031229733 7:119090700-119090722 TTATTGATTTTATAAATGGTTGG + Intergenic
1031417605 7:121511447-121511469 TTACCCATTTTTTCTTTGTTAGG - Intergenic
1035512090 8:199022-199044 TTACAGATTTTATAATTTGGGGG - Intronic
1035932712 8:3801275-3801297 TTTCCCAATTTTTAATTGTTAGG - Intronic
1036088136 8:5635954-5635976 TTACTGATTTTTGCATTGCTTGG + Intergenic
1038397747 8:27259537-27259559 TTATCCACTTGTTAATTGGTGGG + Intergenic
1040690082 8:49926906-49926928 TTACCGATTTTTTAATTGGTTGG - Intronic
1040969008 8:53113811-53113833 TTACCCAATTTATAATTAGTTGG + Intergenic
1041856313 8:62459545-62459567 TTACATATTTTTTCATTGTTTGG - Intronic
1041955066 8:63549568-63549590 TTACAGATTTGTTAAATGATAGG - Intergenic
1042460021 8:69054401-69054423 TTATCCATTTATTAATTGGTGGG - Intergenic
1042924444 8:73952888-73952910 TTGCCCATTTTTGAATTGGGTGG - Intronic
1044455653 8:92389975-92389997 TTAAACATTTTTTAGTTGGTGGG + Intergenic
1045670188 8:104542317-104542339 TTGCCCATTTCTTAATTGGCTGG + Intronic
1045830748 8:106457669-106457691 TTAGGGATTATTTAAGTGGTTGG + Intronic
1050522088 9:6511590-6511612 TAAGCGATTTATAAATTGGTTGG + Intergenic
1051125568 9:13800748-13800770 AGACAGATTTTTTAATTGGCTGG - Intergenic
1051525981 9:18044914-18044936 TTACCAAATTATTAATTGGAAGG + Intergenic
1052126087 9:24776017-24776039 TTACAGATTCTTAAATTGGAAGG - Intergenic
1052243143 9:26299243-26299265 TTACCGATTTTATAAATGGTAGG - Intergenic
1053380488 9:37645503-37645525 TTACCTTTTTTTTTAGTGGTAGG - Intronic
1059054019 9:110959750-110959772 TTATCCATTCATTAATTGGTAGG - Intronic
1059129979 9:111736877-111736899 TTGCCCATTTTTTAATGGGGTGG - Intronic
1059526313 9:114993824-114993846 CTACTGGTTTTTTTATTGGTAGG + Intergenic
1059951484 9:119467014-119467036 TTAGCAATTTTTTAATTTGCTGG + Intergenic
1061819031 9:133213842-133213864 TTATTTATTTTTTAAATGGTTGG - Intergenic
1062755825 9:138287764-138287786 TTACAGATTTTATAATTTGGGGG + Intergenic
1186202988 X:7172794-7172816 TTACCAATTTTGTTATTTGTAGG - Intergenic
1189460456 X:41238569-41238591 GTACCAATGTTTTAATGGGTGGG - Intergenic
1192715664 X:73639347-73639369 TTGCCCACTTTTTAATGGGTTGG + Intronic
1194388892 X:93292144-93292166 TTGCTTTTTTTTTAATTGGTGGG - Intergenic
1195128687 X:101833740-101833762 TTCCCCATTTTCTAATTGGGTGG + Intronic
1195177496 X:102325096-102325118 TTCCCCATTTTTTAATTCGGTGG - Intronic
1195181368 X:102361997-102362019 TTCCCCATTTTTTAATTCGGTGG + Intronic
1196092304 X:111758493-111758515 TTACAGGAGTTTTAATTGGTGGG - Intronic
1196497558 X:116339473-116339495 TTGCCCATTGTTTAATAGGTTGG - Intergenic
1198954506 X:142112987-142113009 TATTTGATTTTTTAATTGGTAGG + Intergenic
1199693687 X:150328472-150328494 TTCCCAATTTATTAATTGGGAGG + Intergenic
1199828231 X:151522020-151522042 TTTCCGAAGTTTTAATTGGTAGG + Intergenic
1201286196 Y:12380797-12380819 TTACAGATTTTCTGATTGGCAGG + Intergenic
1201651062 Y:16287531-16287553 TTCCCTATTTTTTGATTGATTGG - Intergenic
1202382334 Y:24284592-24284614 TTACAGATTTTATAATTTGGGGG + Intergenic
1202488450 Y:25385533-25385555 TTACAGATTTTATAATTTGGGGG - Intergenic