ID: 1040691148

View in Genome Browser
Species Human (GRCh38)
Location 8:49940171-49940193
Sequence CCCAGGTCTTTCAGGGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040691148_1040691152 -7 Left 1040691148 8:49940171-49940193 CCAAATGCCCTGAAAGACCTGGG 0: 1
1: 1
2: 0
3: 13
4: 223
Right 1040691152 8:49940187-49940209 ACCTGGGAAACTGCACCAAAAGG No data
1040691148_1040691154 5 Left 1040691148 8:49940171-49940193 CCAAATGCCCTGAAAGACCTGGG 0: 1
1: 1
2: 0
3: 13
4: 223
Right 1040691154 8:49940199-49940221 GCACCAAAAGGTAGTCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040691148 Original CRISPR CCCAGGTCTTTCAGGGCATT TGG (reversed) Intronic
900012805 1:131377-131399 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
900042869 1:487364-487386 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
900064306 1:722361-722383 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
900350073 1:2230126-2230148 CCCAGGTCTTTCTTGGGGTTGGG + Intronic
901451703 1:9339992-9340014 CCCAGGTGGTTCAGGGCTGTCGG - Intronic
901857396 1:12053110-12053132 CCCAGGTCTTGCTGGGCACCAGG + Intergenic
902142808 1:14370613-14370635 CCCAGGTTTTTCAGCCCAATAGG - Intergenic
903586845 1:24422443-24422465 CCCAGGTATTTCAGGTGGTTAGG - Intronic
904374880 1:30074251-30074273 CACAGATCTATCAAGGCATTTGG - Intergenic
904378589 1:30096582-30096604 CCCAGCCCTATCATGGCATTAGG - Intergenic
905370800 1:37481848-37481870 CCCAAGTCTGTCAGGGCCTCTGG - Intronic
908809098 1:67960643-67960665 CACAGGTCCTTCAGAGCATGGGG - Intergenic
911650972 1:100388081-100388103 CACAGGTATTTTAGGGAATTAGG + Intronic
912017615 1:105061045-105061067 CCCAGGTTTTGCAGGACAGTGGG + Intergenic
912125144 1:106527080-106527102 CCCAGATTTTTCTGGGCAGTGGG + Intergenic
912451576 1:109770656-109770678 TCCAGGGCTGTCAGGGCAGTGGG - Intronic
912493739 1:110077860-110077882 TCCAGGTCTTTCAGTTCATCTGG + Intergenic
915029267 1:152862160-152862182 CCCAGGGCATCCAGGGCACTGGG + Intergenic
915620191 1:157077445-157077467 CCCAGGTCTCTCTATGCATTTGG + Intergenic
915902842 1:159858611-159858633 CCAAGGCCTTTCAGGGAATGAGG - Intronic
917787404 1:178473380-178473402 ACCTTGTCTTTCAGGGCATAAGG + Exonic
920377447 1:205516784-205516806 CCCAGATCTTGAAGGGCCTTTGG + Intronic
922099206 1:222468373-222468395 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
922261243 1:223947867-223947889 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
922735829 1:227977873-227977895 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
924342410 1:243050047-243050069 CCCTGGGCTTTCAGGGCAGATGG - Intergenic
1064120652 10:12615216-12615238 CCCAGGTCCCTCAGGTGATTGGG + Intronic
1064610846 10:17100638-17100660 CACAGGTTATTCAGGGAATTAGG - Intronic
1066416111 10:35223441-35223463 GGCAGGACTTTCAGGGCATAAGG + Intergenic
1066734067 10:38455508-38455530 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1067037722 10:42932313-42932335 CCCAGGGCTTGCAGAGCACTAGG + Intergenic
1069343623 10:67440787-67440809 CCCAGGTATTTGAAGGGATTTGG - Intronic
1070573523 10:77659827-77659849 CCCAGGTTATTCACGGGATTTGG + Intergenic
1071503786 10:86221120-86221142 CCCAGGTGCTTCAGAGCAGTCGG + Intronic
1072357398 10:94624792-94624814 CCCAATTCTTTCAGGACACTGGG + Intergenic
1075447171 10:122521134-122521156 CCCAGTCTTTTCAGGGCACTGGG + Intergenic
1076969141 11:123581-123603 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
1079088139 11:17461764-17461786 CCCAGGTCTTGCAGGTCCTCGGG + Exonic
1088616391 11:111633765-111633787 TCCAGGACTTTTATGGCATTTGG + Intronic
1090255636 11:125281908-125281930 CCTAGGTCTTTCCAGGCACTTGG - Intronic
1092269880 12:7015385-7015407 CCCAGCTCTCTCAGGGAACTGGG - Intronic
1093491417 12:19709320-19709342 CCTTGGTCTTTCAAAGCATTGGG + Intronic
1097053745 12:56238350-56238372 CACAGGTCATGCAGGGCATGGGG + Exonic
1097140364 12:56897661-56897683 CCAAGGCCTGTCAGGGCATGGGG + Intergenic
1103013526 12:117476386-117476408 CTCAAGTCTTTCAGTGCTTTTGG - Intronic
1103894687 12:124265153-124265175 CCCTGCTCTTGCTGGGCATTGGG - Intronic
1104154952 12:126122318-126122340 CCCAGGACTTGCAGGGTATGGGG + Intergenic
1104338956 12:127929607-127929629 CCCCTGTCTGTCTGGGCATTTGG - Intergenic
1104803995 12:131573555-131573577 CCAAGCTCTTTCAGGGCAACAGG - Intergenic
1107456529 13:40560591-40560613 GCCAGGGCTTGCAGGCCATTTGG + Exonic
1107858907 13:44642369-44642391 CCCAGGTACTTCACGGCATCAGG - Intergenic
1111051221 13:82884724-82884746 CCCAGGCTTTACAGGGTATTAGG + Intergenic
1111919638 13:94396618-94396640 CCTGGGTCTTTAAGGGTATTTGG + Intronic
1114881124 14:26787602-26787624 GTCAGGTCTTCAAGGGCATTGGG - Intergenic
1115549967 14:34496122-34496144 GCCAGGTTTTGCAGGGCTTTAGG - Intergenic
1115599007 14:34937836-34937858 CCCTGGTCTTTCAAAGCACTGGG - Intergenic
1116071063 14:40046566-40046588 CCCTTGTCTTTCAGAGCTTTTGG + Intergenic
1121241221 14:92431342-92431364 CCCAGGTCCCACAGGTCATTAGG + Intronic
1122599377 14:102913697-102913719 CCCAGATCTTGCAGGGAATTGGG + Intergenic
1122862283 14:104588011-104588033 CCCAGGTCTTACAGGGGTTGTGG - Intronic
1123965418 15:25451056-25451078 TCCAGATCTTTCAGGGATTTGGG + Intergenic
1124139963 15:27068415-27068437 CCCAGTTCTTACAGTGCATAGGG - Intronic
1124616155 15:31243678-31243700 ACCAGGTTTTTGAGGGCAGTTGG - Intergenic
1128387196 15:67158195-67158217 CCCAGGCCTTATAGGGCACTGGG - Intronic
1128760001 15:70210144-70210166 CCCAGGGCTTTCAGTGCAGCAGG + Intergenic
1130158456 15:81374381-81374403 TCCAGGACTGTCAGGGCATAAGG - Intergenic
1131152743 15:90057175-90057197 CCAAGTTCTTTCAGGGGATGGGG + Intronic
1131436472 15:92426580-92426602 GCCAGCTATTTCAAGGCATTTGG + Intronic
1131890236 15:96964665-96964687 CGCAGGTCTTGCAGGGCAGGAGG - Intergenic
1132471269 16:104769-104791 CCCAGGTCTGCCATGGCCTTTGG - Intronic
1134061704 16:11203139-11203161 CCCAGATGTTTCTGGGAATTTGG + Intergenic
1134643450 16:15847888-15847910 CCCAGATATTTCAGGGAATTAGG - Intronic
1135341418 16:21651368-21651390 CCCAGGACTTTCAGGCTATAGGG - Intronic
1135745589 16:25014299-25014321 TCAAGGTCTTTCAGGGCAGCTGG - Intronic
1136284884 16:29234824-29234846 CCCACTTCTTTCAGGCCACTTGG + Intergenic
1140658261 16:77162702-77162724 GCCAGGTCTTCCAGGACATGGGG - Intergenic
1141809709 16:86367661-86367683 CCCAAATGTGTCAGGGCATTTGG - Intergenic
1141896820 16:86963624-86963646 CCCAGGCCTCTCGGGGCATCGGG + Intergenic
1142089945 16:88204448-88204470 CCCACTTCTTTCAGGCCACTTGG + Intergenic
1142451533 16:90175541-90175563 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1143518353 17:7431141-7431163 CTCATGACATTCAGGGCATTGGG - Intergenic
1143746549 17:8998756-8998778 GCCATCTCTTTCAGGGCAGTAGG + Intergenic
1147984309 17:44296158-44296180 CTCAGATCTTTCAAGGCTTTTGG - Intergenic
1148685194 17:49496898-49496920 GCCAGACCTTCCAGGGCATTCGG - Intronic
1148904053 17:50900353-50900375 CTCAGGACATTCAGGGCATGTGG + Intergenic
1150546378 17:66161669-66161691 ACCGGGTCTGTCAGGGGATTGGG + Intronic
1151326153 17:73380838-73380860 CCCAGGCCTCGCAGGGGATTGGG - Intronic
1153973002 18:10243404-10243426 CTGAGGTTTTTCAGGGCATATGG + Intergenic
1156910499 18:42406490-42406512 CCTAGGAGTTTCAGGGGATTTGG - Intergenic
1158237547 18:55335196-55335218 CCTAGGTAATTCAGGGCATATGG - Intronic
1158648283 18:59266133-59266155 CCCAAGTGTTTCAGGGCCATCGG + Intergenic
1160338400 18:78064027-78064049 CCCAGCTTTTTCAGGTCATGAGG + Intergenic
1160645947 19:193507-193529 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
1162061108 19:8096107-8096129 CCCAGCTCACCCAGGGCATTGGG + Intronic
1162109108 19:8390648-8390670 CCCAGGTCTCTCCGGGCCTCCGG - Intronic
1164528576 19:29029764-29029786 ACCAGGTCTTCCAGGGCTGTGGG + Intergenic
1164694453 19:30233045-30233067 CCCTGGACTTACAGGGCACTGGG - Intronic
1166177257 19:41083012-41083034 CCCAGTGATTTCAGGGAATTGGG + Intergenic
925267854 2:2579790-2579812 CACAGGTCTTTCTGTGCCTTGGG - Intergenic
926646245 2:15292608-15292630 CGCAGATCCTTCAGGGCCTTCGG - Exonic
928464562 2:31511448-31511470 CCCAGGACTTTCAGTTCTTTAGG - Intergenic
929249064 2:39732746-39732768 CCTGGGTCTCTAAGGGCATTAGG + Intergenic
929620063 2:43345662-43345684 GCCAGCTCTTTCAGGACAGTGGG - Intronic
934024681 2:87991558-87991580 CCCAGGTCGTTCAGAGAATTCGG + Intergenic
934123779 2:88866474-88866496 GCCAGGATTATCAGGGCATTTGG - Intergenic
935775755 2:106469635-106469657 CCCAGGTCGTTCAGAGAATTGGG + Intergenic
936365370 2:111849595-111849617 CCCAGGTCATTCAGAGAATTCGG + Intronic
936530988 2:113277178-113277200 CCCAGGTCTCTGAGGGGAATGGG + Intronic
936974526 2:118205814-118205836 CCCAGTTATTTCAGGACTTTTGG + Intergenic
940318950 2:152354081-152354103 CCCAGGTGTTTCAGGGCATTGGG + Intronic
940506408 2:154559523-154559545 CCAGGGCCTGTCAGGGCATTGGG + Intergenic
940766710 2:157797732-157797754 CCCAGGCATTTCAGTGCCTTTGG - Intronic
942401687 2:175609685-175609707 CCCATGGCGTTCAGGACATTTGG + Intergenic
947069913 2:226277422-226277444 CCCACATCGTTCAGAGCATTTGG - Intergenic
947367540 2:229412682-229412704 CCCACGTCATTCATGGCATCTGG + Intronic
947518170 2:230824790-230824812 TCCAGGACGCTCAGGGCATTTGG - Intergenic
947877818 2:233479719-233479741 CCCAGGTCTCTGAGGGCACCAGG + Intronic
948480249 2:238245256-238245278 CCCAGCACTTTTAGGTCATTTGG - Exonic
948856630 2:240733266-240733288 CCCAGATCTTTCCGAGCATGGGG + Intronic
948861170 2:240753234-240753256 ACCTGGCCTTTCAGGGCAGTGGG - Intronic
1169019036 20:2315076-2315098 CCCACCTCTTCCAGGCCATTTGG - Intronic
1170385790 20:15815011-15815033 CACAGGTATTTCAGGGCAGAGGG + Intronic
1170464779 20:16612663-16612685 CCCAGGTCTTTGTGGGCCATTGG - Intergenic
1172693022 20:36803524-36803546 CCCAGGTCTTTGGGGGCAGCAGG + Intronic
1175475744 20:59272884-59272906 CCCAGCTCTGTCAGAGCAGTGGG + Intergenic
1175656158 20:60772836-60772858 CCCAGCTCTATCTGGGCATGAGG + Intergenic
1175881990 20:62264799-62264821 CCCAGGACCCTCATGGCATTTGG + Intronic
1176279559 20:64292709-64292731 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1177671986 21:24244478-24244500 ACAAGTTCTTTCAGTGCATTAGG + Intergenic
1178778008 21:35570977-35570999 CCACAGTCTTTCATGGCATTTGG + Intronic
1179270199 21:39844965-39844987 CACAGGTCTTCCCGGGCTTTGGG - Intergenic
1180020165 21:45118903-45118925 GCCAGGGCTTTTAGGGCATAAGG - Intronic
1181105867 22:20574915-20574937 TCCAGGTCTGTCTGGGCATTGGG - Intronic
1184331276 22:43829414-43829436 CCCTGGTCCTCCAGGGAATTGGG + Intronic
1185272159 22:49934667-49934689 CCCAGGTCCTGCAGGGGAGTGGG + Intergenic
949461932 3:4303329-4303351 CCCAGGACTGTCAGGGTAGTGGG + Exonic
949507413 3:4740563-4740585 TCCAGGCATTTCAGGGCTTTAGG - Intronic
950070717 3:10149897-10149919 TCCAGGTCTTTCTGCACATTTGG - Exonic
950717372 3:14858816-14858838 GCCAGGTCTGTCACAGCATTTGG + Intronic
955087986 3:55721591-55721613 CCAAGGTTTCTCAGTGCATTGGG + Intronic
956081029 3:65556377-65556399 CTCAGGTGGTTCAGGGCATGGGG - Intronic
956470264 3:69559214-69559236 CCCATGCATTTCAGGGCATTAGG + Intergenic
956650679 3:71501836-71501858 ACCAGGGTTTTCAGGGCACTGGG - Intronic
956657446 3:71566261-71566283 CCCACCTCTGTCAGGGCAGTTGG - Intronic
956781325 3:72605624-72605646 TCCTGGTGTTGCAGGGCATTAGG + Intergenic
958175133 3:89988274-89988296 AGCACGTCTTTCATGGCATTAGG - Intergenic
959828453 3:110831018-110831040 CCCAGGCCTGTCAGGGGGTTGGG - Intergenic
961453438 3:127012985-127013007 CCCAGGGCTTCCAGGGGATGGGG - Intronic
968371734 3:198226019-198226041 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
968637928 4:1691948-1691970 CCCAGCTCTTTCAGGGTGGTAGG - Intergenic
968749969 4:2383559-2383581 CCCAGGTCATCCTGGGCATTGGG - Intronic
970878375 4:20898492-20898514 CCCATGTATATCAGGACATTTGG + Intronic
972246585 4:37251406-37251428 CCCAGATCTTTCATGGAATTAGG + Intronic
972304989 4:37822291-37822313 ACAAGGTATTTGAGGGCATTGGG + Intergenic
972715993 4:41646675-41646697 CGCAGGTATTTCATGGGATTGGG - Exonic
979260422 4:118638497-118638519 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
980637255 4:135523555-135523577 CCAGAGTCTTTCAGGGCAGTAGG + Intergenic
980892574 4:138831041-138831063 CCCAGGTGTTTCTCAGCATTTGG - Intergenic
984317036 4:178141252-178141274 CCCATGCCTTTAGGGGCATTGGG - Intergenic
987148818 5:15018123-15018145 CCCAGGTCTGCCAGGGCAGCTGG + Intergenic
988316767 5:29641320-29641342 CCCAGGACTCTCAGGTCTTTCGG - Intergenic
990235876 5:53766669-53766691 CTCAGGCCTTTGAGGCCATTAGG + Intergenic
993029430 5:82688152-82688174 CCGAGGCCTGTCAGGGGATTGGG + Intergenic
995112800 5:108446190-108446212 CTGAGGTCTTTCAGGGAGTTTGG + Intergenic
996353685 5:122573829-122573851 CCCAGGACTTTGAGGGCAGCTGG + Intergenic
996754433 5:126921199-126921221 CCACGGTCTTTCAGGGCTGTTGG - Intronic
996764147 5:127018735-127018757 ACCATGGCTTACAGGGCATTGGG - Intronic
998449956 5:142226561-142226583 ACCAGGGCTTTTAGGGCACTTGG + Intergenic
1001732269 5:173969231-173969253 GCCAGGTCTTGCAAGGCCTTGGG - Intergenic
1002730974 5:181331565-181331587 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1002753559 6:142539-142561 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
1003114877 6:3277115-3277137 CCCAAGTCTTTCAGGGTCTAGGG + Intronic
1003435755 6:6086490-6086512 CCCAGGGCTTTCTGGCCAGTAGG + Intergenic
1006282246 6:33063613-33063635 CCAGGGTCTGTCAGGGCATGGGG - Intergenic
1006475089 6:34248191-34248213 CCCAGCCCTTTTGGGGCATTGGG + Intronic
1006499423 6:34448465-34448487 CCCAGGGCTGGCAGGGCATACGG + Intergenic
1006974020 6:38079893-38079915 CCCAGGACTTTCTGGGTGTTGGG + Intronic
1008726849 6:54431934-54431956 CACACACCTTTCAGGGCATTTGG + Intergenic
1011681891 6:89791533-89791555 CCCAGGTCTATCAGGTCCATGGG + Intronic
1011961210 6:93092842-93092864 CCCAGGTTTTTCAGGCCATACGG + Intergenic
1012020286 6:93909287-93909309 CCAAGGCCTTTCAGGGGAGTAGG + Intergenic
1014767357 6:125422114-125422136 TCCAGGTCTCTCAGGGTCTTGGG - Intergenic
1015462350 6:133505907-133505929 CCCAGGTGTGTCTGTGCATTTGG + Intronic
1016814021 6:148287087-148287109 CCCAGGTCTCTGATGGCATCAGG + Intronic
1016953412 6:149603280-149603302 CCGAATTCTTTAAGGGCATTAGG - Exonic
1018132620 6:160747215-160747237 CCCAGGTCTAGGATGGCATTTGG + Intronic
1019421185 7:952059-952081 CCCAGGTCTTGCAGGACAGTGGG + Intronic
1020135516 7:5585886-5585908 CCCAGAGCCTTCAGGGCTTTGGG + Intergenic
1020369222 7:7414423-7414445 TCCAGCTCCTTCAGGGCCTTGGG - Intronic
1021483140 7:21140287-21140309 CACAGGTCTTTAATGGCATAAGG + Intergenic
1022500476 7:30879504-30879526 TGCAGGTCTGGCAGGGCATTGGG - Intronic
1023402139 7:39798097-39798119 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1023840504 7:44094560-44094582 CCCAGGTCTTCCAGAGCACCAGG - Intergenic
1023865044 7:44234523-44234545 CCCGTGTCTCTCAGGGCATGGGG + Intronic
1024076120 7:45818727-45818749 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1024647484 7:51382563-51382585 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
1025051318 7:55737058-55737080 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
1025060084 7:55798313-55798335 CCCTGGGCTTTCAGGGCAGGTGG - Intronic
1025128283 7:56362725-56362747 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
1025176665 7:56805606-56805628 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic
1025695127 7:63770780-63770802 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1027800076 7:82739277-82739299 CTCAGGTCTTTCAGCAGATTTGG - Intergenic
1029140732 7:98407944-98407966 CCCAGGTATTTCCTGTCATTTGG + Intergenic
1030379789 7:108799310-108799332 CCCAGGTCTCTCATGGCATCAGG + Intergenic
1032052652 7:128658490-128658512 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1034541088 7:151758648-151758670 CCCAGGTCTATCAGTGCCTTCGG - Intronic
1037768345 8:21785167-21785189 CCCAGGGGATTCAGGGCATAAGG + Intronic
1040691148 8:49940171-49940193 CCCAGGTCTTTCAGGGCATTTGG - Intronic
1040963526 8:53061098-53061120 CCCTAGTCTTTCAGGTCACTGGG - Intergenic
1043581401 8:81720298-81720320 CCAAGGTCTCTCAGTGCAATGGG + Intronic
1046790714 8:118318941-118318963 CCCAGGTTTGTCAGGGCAAGGGG + Intronic
1050333600 9:4569852-4569874 CCCAGGCCCTGCTGGGCATTGGG + Intronic
1051586526 9:18732580-18732602 CCCAGGCCTTTCTGGCCATCGGG - Intronic
1055530406 9:77177778-77177800 CCCAGCTCTCTCTGGGCATCTGG + Exonic
1055605550 9:77966935-77966957 CCCAGGTCTTTCATTGCCCTAGG + Intronic
1057955847 9:99407215-99407237 CCCAGGCCTTTCCAGGCTTTTGG - Intergenic
1060088351 9:120721361-120721383 CCCAGGCCTTGCAGGGTTTTGGG + Intergenic
1060775894 9:126374293-126374315 CCCAGATCTTTCAGGGATTAAGG + Intronic
1062038469 9:134393183-134393205 CCCAGGTCGCTCATGGCTTTAGG - Intronic
1062172900 9:135145211-135145233 GCCAGGTCTTTCCAGGCATGCGG + Intergenic
1062755380 9:138284072-138284094 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1203760456 EBV:10588-10610 CCCAGGCCTTGCAGGGCAGACGG + Intergenic
1203579293 Un_KI270745v1:28244-28266 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1194758932 X:97770919-97770941 CCAAGGCCTTGCAGGGAATTAGG - Intergenic
1195063538 X:101219208-101219230 CCCAGGTCTCTGAGGGTGTTTGG + Intergenic
1198333481 X:135643996-135644018 CACAGGTCTTGCAGAGCAATTGG - Intergenic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic
1202381900 Y:24280866-24280888 CCCTGGGCTTTCAGGGCAGGTGG + Intergenic
1202488884 Y:25389259-25389281 CCCTGGGCTTTCAGGGCAGGTGG - Intergenic