ID: 1040696667

View in Genome Browser
Species Human (GRCh38)
Location 8:50007679-50007701
Sequence GTCACAGTGAGCTAAGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040696662_1040696667 15 Left 1040696662 8:50007641-50007663 CCTGAATGATAAGAGATTCCATA 0: 1
1: 0
2: 3
3: 14
4: 175
Right 1040696667 8:50007679-50007701 GTCACAGTGAGCTAAGAGGGTGG No data
1040696664_1040696667 -3 Left 1040696664 8:50007659-50007681 CCATAGGATTTCAGAGAAGAGTC 0: 1
1: 0
2: 1
3: 18
4: 195
Right 1040696667 8:50007679-50007701 GTCACAGTGAGCTAAGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040696667 Original CRISPR GTCACAGTGAGCTAAGAGGG TGG Intronic
No off target data available for this crispr