ID: 1040697753

View in Genome Browser
Species Human (GRCh38)
Location 8:50022749-50022771
Sequence CAGTGGGAACAGAGGCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 370}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040697753_1040697766 30 Left 1040697753 8:50022749-50022771 CCATGTTGCCTCTGTTCCCACTG 0: 1
1: 0
2: 0
3: 31
4: 370
Right 1040697766 8:50022802-50022824 TAAGTGAAGGGTTGAGGGTGTGG No data
1040697753_1040697762 17 Left 1040697753 8:50022749-50022771 CCATGTTGCCTCTGTTCCCACTG 0: 1
1: 0
2: 0
3: 31
4: 370
Right 1040697762 8:50022789-50022811 CACAGTTCTTGGTTAAGTGAAGG No data
1040697753_1040697765 25 Left 1040697753 8:50022749-50022771 CCATGTTGCCTCTGTTCCCACTG 0: 1
1: 0
2: 0
3: 31
4: 370
Right 1040697765 8:50022797-50022819 TTGGTTAAGTGAAGGGTTGAGGG No data
1040697753_1040697764 24 Left 1040697753 8:50022749-50022771 CCATGTTGCCTCTGTTCCCACTG 0: 1
1: 0
2: 0
3: 31
4: 370
Right 1040697764 8:50022796-50022818 CTTGGTTAAGTGAAGGGTTGAGG No data
1040697753_1040697763 18 Left 1040697753 8:50022749-50022771 CCATGTTGCCTCTGTTCCCACTG 0: 1
1: 0
2: 0
3: 31
4: 370
Right 1040697763 8:50022790-50022812 ACAGTTCTTGGTTAAGTGAAGGG No data
1040697753_1040697759 6 Left 1040697753 8:50022749-50022771 CCATGTTGCCTCTGTTCCCACTG 0: 1
1: 0
2: 0
3: 31
4: 370
Right 1040697759 8:50022778-50022800 AACCCAAAATGCACAGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040697753 Original CRISPR CAGTGGGAACAGAGGCAACA TGG (reversed) Intronic
900383693 1:2399201-2399223 CTGTGGGAACAGAGACAAAGCGG - Intronic
900861336 1:5234519-5234541 CAGAGGGAAGAGCGGCACCAGGG - Intergenic
901646513 1:10719714-10719736 CAGTGAGAGAAGAGGCAGCAGGG + Intronic
902050745 1:13562041-13562063 CAGTGGGAACAGAGACTAGAGGG - Intergenic
902338187 1:15765803-15765825 CAGGGGGACCCGAGGCCACAGGG - Intronic
902782472 1:18713305-18713327 CAGTAGGACCACAGGCAGCATGG + Intronic
904123747 1:28221470-28221492 TAGTGAGAACAAAGGCTACAGGG + Intronic
904318708 1:29682661-29682683 CAGTGGGGTCAGAGGGAGCAGGG - Intergenic
904406104 1:30289159-30289181 CTATGGGTCCAGAGGCAACAGGG - Intergenic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905774124 1:40657291-40657313 CAGTGGGGAAAGAGGCAGGATGG + Intronic
906834055 1:49063843-49063865 CTGGAGGAACAGAAGCAACAGGG - Intronic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907362333 1:53928551-53928573 CACTGGGATCAGAAACAACATGG + Intronic
907861413 1:58357243-58357265 CAGTGAGAACAGAGGGAAATGGG + Intronic
912600289 1:110924453-110924475 CAGAGGGCAAAGAGGCAGCAAGG + Intergenic
914513103 1:148351905-148351927 CAGGTGGAAGAGGGGCAACAGGG + Intergenic
915044696 1:153002337-153002359 CAGTGTGAACAGAGGCTCCCAGG + Intronic
915507754 1:156368242-156368264 CAGTGGGCACACAGGGAACCTGG + Intergenic
915554197 1:156652420-156652442 CAGTGGGGAGAGAGGCCTCAGGG - Exonic
915597583 1:156904349-156904371 CAGGGGGAGCAAAGGAAACAGGG + Intronic
916459569 1:165009421-165009443 CAGTGGCAAGAGAGGCCACTGGG - Intergenic
918025873 1:180745510-180745532 CAGTGAGAACAGTAGTAACAGGG - Intronic
918535889 1:185573947-185573969 CATAGAGAATAGAGGCAACATGG + Intergenic
919534142 1:198765757-198765779 GAGTGGGAATAGAGGCAAGGAGG - Intergenic
920186236 1:204161159-204161181 CAGTGGGCACAGAGGCAGAGAGG + Intronic
921279315 1:213549965-213549987 CAGTGGGGAGAGGGGCATCAGGG + Intergenic
922141746 1:222894417-222894439 CAGAGGGGACTGAGGCAGCAGGG + Intronic
924246852 1:242093635-242093657 CTTTAGGATCAGAGGCAACATGG - Intronic
924258247 1:242203618-242203640 CAGTGGCAAGAGAGGGAGCAAGG - Intronic
924895710 1:248336237-248336259 CAGTGGGATTAGGGGCAGCATGG + Intergenic
1063505993 10:6600214-6600236 CAGTGGGCTGAGAGCCAACAGGG - Intergenic
1064728840 10:18308482-18308504 CAATGGGAACACAGACACCAGGG - Intronic
1065122318 10:22542046-22542068 AACTGGGGACAGAGGCAACAGGG + Exonic
1065552381 10:26881861-26881883 CAGTGACAACATAGGCAGCATGG + Intergenic
1066580879 10:36880660-36880682 CAGTGACAATATAGGCAACATGG + Intergenic
1067430527 10:46240635-46240657 CAGTGGTAGCAGCAGCAACAGGG - Intergenic
1068114525 10:52722755-52722777 CAGGAGGAACAGAGGGAACAGGG + Intergenic
1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG + Intergenic
1069888155 10:71636851-71636873 CAGAGGAAAAAGAGGCAGCAGGG + Intronic
1072867985 10:99084824-99084846 CAGTGGTAACAGGGGCAAGTTGG - Intronic
1074223305 10:111459625-111459647 CTGTGGGAAGAGAGGCTGCAAGG - Intergenic
1075017109 10:118917951-118917973 GAGAGGGGACAGAGGGAACAGGG + Intergenic
1075574913 10:123571203-123571225 CAGTGGGAAGAGAGGCCCCATGG - Intergenic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076581882 10:131517357-131517379 CAGAGGCAACAAAGGCAGCAGGG - Intergenic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077121325 11:910310-910332 CAGAGGGAGCAGAGGCAGTAGGG - Intronic
1077148492 11:1056637-1056659 CAGTGGGAAGAGAGGCCCCTGGG - Intergenic
1077332094 11:1988266-1988288 CAGTGGGCACGGAGCCAGCAGGG - Intergenic
1077402657 11:2366826-2366848 CAGTGGGAACAGCGCCACCGTGG - Intergenic
1077873289 11:6281381-6281403 CAGATGGAACAGAGACAAAAAGG + Intergenic
1078860129 11:15239145-15239167 CAGTGGCAACAGTGGACACAGGG + Intronic
1079009246 11:16814854-16814876 CAGTGGCCACGGGGGCAACAAGG + Intronic
1079146023 11:17852683-17852705 AAGTAGGTACAGATGCAACAGGG + Intronic
1079499980 11:21092247-21092269 CAGTGGGAACAGTGTCTATAGGG + Intronic
1080327476 11:31094145-31094167 CAATGGAAACAGAGGCATGAAGG + Intronic
1080784620 11:35463438-35463460 CCGGGGGAACAAAGGCAACATGG + Intronic
1084079581 11:66812590-66812612 CAGTGGGCACTGAGGCATTATGG - Intronic
1085212495 11:74793846-74793868 CAGTGGGAAGAAAGGTAAAAAGG - Intronic
1085939234 11:81188337-81188359 AAGTGGGAAAAGAGGAAAAAAGG + Intergenic
1086160769 11:83719565-83719587 CAGTGAGAAAAGAGGCAAGGTGG + Intronic
1086458407 11:86982027-86982049 TAGTGGTAACAGAGGCCACACGG - Intergenic
1088249135 11:107847708-107847730 CAGGAGGGACAGAGGAAACAGGG + Intronic
1088692051 11:112336610-112336632 CAGTGTGCACAGAGGCAAAGGGG + Intergenic
1088763898 11:112958469-112958491 CAGTGGGAAAGGAGGCAAAAAGG - Intergenic
1088946429 11:114517860-114517882 CTGTGGGAGCAGAGCCACCAGGG - Intergenic
1089539739 11:119182568-119182590 CAGTGGGACCAGAGACAGTAGGG - Intronic
1090612132 11:128480584-128480606 GAGTGGGAACAGAAGCTTCAGGG + Intronic
1091016706 11:132058060-132058082 CAGAGGGATCAGAGCTAACAGGG - Intronic
1202815075 11_KI270721v1_random:43442-43464 CAGTGGGCACGGAGCCAGCAGGG - Intergenic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1097951169 12:65429614-65429636 CAGTGGGCCCAGTGGGAACATGG - Intronic
1098013564 12:66080373-66080395 AAGTGGGAAGAGAGGCTCCATGG + Intergenic
1098962094 12:76749269-76749291 TAGTTGGAACAGAGGCCATATGG - Intergenic
1099027482 12:77483704-77483726 CAACAGGAACAGAGTCAACAAGG - Intergenic
1101012731 12:100467670-100467692 CAGTGGGGACAGAGGCCAGTTGG + Intergenic
1101562870 12:105875840-105875862 CATTAAGAACAGAAGCAACAAGG + Intergenic
1101604560 12:106238321-106238343 CAGTGGGGACAGAGGGCACCGGG + Exonic
1102599733 12:114020707-114020729 CTCTGGGAACAGAGACAAGAAGG + Intergenic
1102940487 12:116937103-116937125 CAGAAGGAAGAGAGTCAACAAGG + Intronic
1102993339 12:117330397-117330419 CAGTGGGAGCAGAGGGGTCAAGG - Exonic
1104510384 12:129372454-129372476 CAGTGGCATTAGAGGCCACATGG + Intronic
1104532456 12:129584902-129584924 GAGTGGGGACAGAGCCAGCATGG + Intronic
1105940234 13:25141346-25141368 GAGTGGGAACAGAGTCACCAGGG - Intergenic
1106075694 13:26459198-26459220 TAGTGGGAACTCAGGCACCATGG + Intergenic
1106079128 13:26486016-26486038 CAGAAGGAACAGAGAGAACAGGG + Intergenic
1106506956 13:30378869-30378891 AAGAGGAAACAGAGGCAACAAGG - Intergenic
1106766755 13:32921111-32921133 TAGTGGGAAATGAGGAAACATGG - Intergenic
1106809788 13:33349220-33349242 GAGAGGACACAGAGGCAACAAGG + Intronic
1107816836 13:44252036-44252058 AGGTGGGAGCAGAGGCGACAGGG - Intergenic
1108542486 13:51456717-51456739 CAGAGGGGACTGAGGCAGCATGG + Intergenic
1109968009 13:69726757-69726779 GAGTTGGAGCAGAGGAAACACGG - Intronic
1111412629 13:87896238-87896260 CAGTGGGAGCAGAGTCAGGATGG - Intergenic
1114690997 14:24581137-24581159 GATTGGGAAAAGAGCCAACATGG - Intergenic
1114928725 14:27439373-27439395 CAGAGGGAACAAAGACAAAAGGG - Intergenic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1115097951 14:29661534-29661556 GAAAGGGAACAAAGGCAACAGGG + Intronic
1115975788 14:38995516-38995538 CAGAGGGAACTGATGCAACCGGG - Intergenic
1117841242 14:59862647-59862669 CAGTGGGAACAGATGGGAAATGG - Intronic
1118061187 14:62139296-62139318 CAGTGGGAACAAATGCACCAGGG + Intergenic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1120501321 14:85300595-85300617 CAGTGAGAGCAGAAGCTACAAGG + Intergenic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1122168752 14:99853343-99853365 CAGTGGAAACAGGGGCAGGAGGG + Intronic
1122605256 14:102943842-102943864 CGGTGGGAAAAGCAGCAACAGGG + Intronic
1123796561 15:23777909-23777931 CAGTAGGAACTGAGGTAACTAGG + Intergenic
1124252612 15:28116932-28116954 CAGGGAGCACAGAGGCCACATGG - Intronic
1125769918 15:42158291-42158313 CAGATGGGACAGAGACAACAAGG + Intergenic
1126705832 15:51404051-51404073 CTGTGCTAGCAGAGGCAACAGGG - Intronic
1127628495 15:60803535-60803557 CAGTGGGTTCAGAGCCCACAAGG + Intronic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1129709424 15:77812966-77812988 CAGTGGCCACAGAGGCCCCAAGG + Intronic
1129968538 15:79757813-79757835 CTGGGGGACCAGAGGCAGCACGG + Intergenic
1130144264 15:81261438-81261460 CAGGGGGAAGAGAGCCACCAGGG + Intronic
1131283329 15:91038482-91038504 CAGCGGGGTCAGAGGCCACAGGG + Intergenic
1131568363 15:93506614-93506636 CAGAGGGGACTGAGGCAGCAGGG + Intergenic
1132029291 15:98427301-98427323 AAGAGGGAAGAGAGGGAACAAGG - Intergenic
1134131040 16:11650496-11650518 CAGTGGGATCAGAGGCCAGCTGG + Intergenic
1134365179 16:13570627-13570649 CAGTGTGAACAGTGTGAACAAGG + Intergenic
1135222777 16:20627247-20627269 CACTGGGGACAGAGGTAAGATGG - Exonic
1135641642 16:24124826-24124848 CAGTGGGAATACAGGAAAGAGGG - Intronic
1137582058 16:49639583-49639605 CAGTGGGAACAAAGAAAACAAGG - Intronic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1139602953 16:67997923-67997945 CAGTGGGCAGAGTGGAAACAAGG - Intronic
1139615063 16:68084054-68084076 CAGTGGGAAGAGAGGGTAAAGGG - Intergenic
1139828774 16:69779476-69779498 CAGAAGGAACAAAGGCAACTGGG - Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1141365129 16:83435504-83435526 CAGAGTGAAGAGAGGCAGCAGGG - Intronic
1141383162 16:83594352-83594374 CAGTGAGAACATAAGCAACTTGG + Intronic
1141485204 16:84334211-84334233 CAGTGGTGACAGTGGCCACAGGG + Intergenic
1143478341 17:7215529-7215551 CAGCGGGAGCAGAGGAAACCAGG + Intronic
1144936162 17:18900837-18900859 CAGTGGTATCAGAGGCAGCCTGG - Intronic
1145276121 17:21431881-21431903 CAGTGTGCACAGAGGTCACAGGG - Intergenic
1145313965 17:21717795-21717817 CAGTGTGCACAGAGGTCACAGGG - Intergenic
1147587241 17:41659518-41659540 CAGGGGGAAGAGAGGCACCCTGG + Intergenic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1150201586 17:63362615-63362637 CAGAGGGGACTGAGGCAGCATGG + Intronic
1150324402 17:64244635-64244657 CAGTGGGAACAGTGACTAAAGGG - Intronic
1150533728 17:66013806-66013828 CAGTGGCAGCAGTGGCACCATGG + Intronic
1151562445 17:74877935-74877957 CAGGGGGCACAGAGAGAACAGGG - Exonic
1152101790 17:78305755-78305777 CAGTGGGGACAGAGGCTGCAGGG - Intergenic
1152685090 17:81689995-81690017 CAGTGAGGACAGAGGCCCCATGG + Intronic
1152862223 17:82703094-82703116 CAGCGGGGGCAGAGGCAACAAGG + Intergenic
1152979575 18:263597-263619 TAGAGGGAATAGAGCCAACATGG - Intronic
1153230038 18:2926434-2926456 CAGGGGGAGCAGAGGCACCTGGG + Intronic
1153945686 18:10015282-10015304 CAGGAGGAACGGAGGCAACTTGG - Intergenic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156398711 18:36721695-36721717 CAGTGGTAACATATGCAAAATGG - Intronic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157449717 18:47776277-47776299 CAGTTGGGACACAGGCAAGAAGG + Intergenic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1157627369 18:49061683-49061705 CAGTGGGAACAGAGGAGAGCTGG + Intronic
1157677846 18:49580384-49580406 GAGTTGGAACAGAGGCAATACGG - Intronic
1157913888 18:51645488-51645510 CAGTGGGTCCAGAAGCAGCATGG + Intergenic
1158453294 18:57586091-57586113 AAGTGGGCACAGAGGGACCAAGG + Intronic
1158652748 18:59302142-59302164 CATTAGGAAGAGAGGAAACAAGG - Intronic
1159475547 18:68916441-68916463 AAGCAGGAAAAGAGGCAACAAGG - Intronic
1160113461 18:76055543-76055565 GCATGGGAACAGAGGAAACAAGG + Intergenic
1160805516 19:990775-990797 CCATGGGAACAGGGGCACCAGGG - Intronic
1160893817 19:1393526-1393548 CAGAGGGATCAGAGGGAGCAGGG + Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1162059432 19:8085850-8085872 CAGAGGGAAGAGGGGCAGCAGGG + Intronic
1162263306 19:9549994-9550016 AAGTGGGATGAGGGGCAACATGG - Intergenic
1162372319 19:10287011-10287033 CAGAGGGAACAGAGACCCCATGG - Exonic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1164398776 19:27888588-27888610 CAGTGAGAACATCTGCAACATGG + Intergenic
1164484704 19:28645003-28645025 TAGTGGGAAAAGAGGAAACAAGG + Intergenic
1164668475 19:30059173-30059195 CAATGTGAATAGAGGCAACTGGG + Intergenic
1164744478 19:30601073-30601095 CTGTGGGAACACAGGGAATATGG - Intronic
1165739715 19:38197985-38198007 AGGCGAGAACAGAGGCAACACGG - Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1166683728 19:44782584-44782606 GAGTGGGAACAGAGGTACCCAGG + Intronic
1167117540 19:47496979-47497001 CAGTGGAAACGGTGGCAAAAAGG + Intronic
1167139029 19:47636850-47636872 CAGTGGGAAGTGAGGTTACAGGG - Intronic
1167274260 19:48526734-48526756 TAGTGGTAACAGAGACCACATGG + Intergenic
1168637541 19:58008295-58008317 CAGTGGTCATAGAGGCAATAAGG + Exonic
925151549 2:1618705-1618727 CAGTGGGAACAGACTGAACCAGG - Intergenic
925234402 2:2265526-2265548 CAGTGGGTACAGAGGGGACCAGG + Intronic
926847300 2:17155926-17155948 GAGGGGAAACAGAGTCAACATGG - Intergenic
927241122 2:20920246-20920268 CAGTGGGAACAAAGGCATAGAGG + Intergenic
928200138 2:29242649-29242671 CTGTGTGACCTGAGGCAACATGG + Intronic
928923269 2:36548694-36548716 CAGTGTGAAGAAAGGCAACTAGG + Exonic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929090400 2:38210887-38210909 CAGTGTCAGCAGAGACAACATGG + Intergenic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
930343535 2:50148691-50148713 CAGTGTGAACAGTAGCATCAGGG - Intronic
930948342 2:57105292-57105314 CTGTGAGAGCAGAGGCCACAGGG + Intergenic
931224115 2:60314676-60314698 CAGAGAGACCCGAGGCAACATGG - Intergenic
932402157 2:71488486-71488508 CAGGGGGCCCAGATGCAACAAGG + Intronic
932417807 2:71584263-71584285 GAGTGGGAGCAGAGGCAAAGCGG + Intronic
932704092 2:74010027-74010049 CAGTGGGAGGAAAGGCCACAGGG - Intronic
934219217 2:90066014-90066036 CAGTGGGAAAATAGGCCAAAAGG - Intergenic
934641478 2:96029664-96029686 CAGTGGGAACAGGGGCAGTGAGG - Intronic
934967881 2:98738619-98738641 CGGTGTGAACAGAGGCATCATGG + Intergenic
935402141 2:102671200-102671222 CAGTGAGAAGAGAAGAAACAAGG - Intronic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
935631415 2:105215585-105215607 CAGTAAGAGCAGAGGCTACAAGG - Intergenic
935897803 2:107756467-107756489 CAATAGGAAGAGAGGAAACAAGG - Intergenic
937314432 2:120921984-120922006 GAGAGGGAACAGAGGAGACATGG - Intronic
937543680 2:122989300-122989322 CAGGGGGAGCTGAGGCAGCAGGG - Intergenic
940392966 2:153154042-153154064 CAGAGGGAACAGAGACAAATGGG - Intergenic
940784049 2:157962972-157962994 GAGGGGGAAGAGAGGGAACAAGG + Intronic
943137293 2:183929865-183929887 CTGTGGGGACAGAGACACCAAGG - Intergenic
943247350 2:185473078-185473100 CAGAGGGGCCTGAGGCAACAGGG - Intergenic
943258480 2:185628441-185628463 CAGTGTGTACAGAGATAACATGG - Intergenic
943506460 2:188766204-188766226 CAATGGGAACAAATGCAAAATGG - Intronic
943704846 2:191023485-191023507 CAGGGGAAACAGAGAGAACATGG + Intergenic
944891414 2:204120904-204120926 CAGTGGCTACAGAGGCAGCCAGG - Intergenic
945770455 2:214035490-214035512 CAGAGGGGGCTGAGGCAACAGGG + Intronic
946681793 2:222224870-222224892 CAGTAGCAACAGAGGCAAACTGG + Intronic
946993749 2:225366787-225366809 GAGTTGTAACAGAGACAACAAGG + Intergenic
947379209 2:229528855-229528877 CAATGGGAACAGAGGCTCTAGGG - Intronic
948157670 2:235797350-235797372 CACTGGGAACAGGAGCCACATGG - Intronic
948268753 2:236657708-236657730 GATTGGGAACAGAGACCACATGG - Intergenic
948806998 2:240457311-240457333 CAGCAGGCACAGAGGCTACAGGG + Intronic
949042102 2:241854216-241854238 CCATGGGCACAGAGGGAACAGGG - Intronic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1169794956 20:9452024-9452046 CAGTGGGAACAAAGGCTAGGTGG - Intronic
1170588950 20:17756583-17756605 CAGTGGGGACAGAGGCAGATTGG + Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171413324 20:24960772-24960794 CAATGGGAACTGAGGCTCCAAGG - Intergenic
1174051155 20:47768534-47768556 CTGTGTGAACAGAGGCCTCAGGG + Intronic
1175966713 20:62663491-62663513 CGGTGTGAGCAGAGGCGACATGG + Intronic
1176132353 20:63501716-63501738 CTGCGGGGACAGAGGCTACAAGG + Intergenic
1178226347 21:30723773-30723795 CACTGGGGACAGAGGCAGAATGG - Intergenic
1178931220 21:36820579-36820601 CAGTGGGGACTGAGGCAGCAGGG - Intronic
1179625362 21:42646183-42646205 GAGTGGGGACAAAGGCTACAGGG + Intergenic
1180612229 22:17105565-17105587 CAATGAGAACAGAGGAAAAAGGG - Intronic
1182046368 22:27277339-27277361 CAGTGGATACGGTGGCAACACGG + Intergenic
1182878159 22:33710035-33710057 AAGTGGGAACATAGACAACAGGG - Intronic
1183214323 22:36469319-36469341 CAGTGGCTACAGAGGGCACAAGG + Intronic
1183387347 22:37522522-37522544 CAGTCCCAGCAGAGGCAACAGGG - Intergenic
1183554303 22:38513244-38513266 CAGGGGGAGCAGGGGCAGCAGGG - Intergenic
1183661605 22:39224759-39224781 CACTGTGCACAGAGGCACCAGGG + Exonic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1184786921 22:46676492-46676514 CACTGGGCACACAGGCAGCAGGG - Intronic
1185032434 22:48451488-48451510 TAGTGGGAACAGCGGAAACAGGG + Intergenic
1185108696 22:48888724-48888746 CTGTGGAAACAAAGGCAGCAAGG + Intergenic
1185370481 22:50458719-50458741 CGGTGGGGACAGAGACAGCAAGG + Intronic
949570310 3:5285787-5285809 CAGTGGCAAAAGTTGCAACAGGG + Intergenic
950182559 3:10926043-10926065 CAGCGGGGAGAGAGGCATCATGG - Exonic
951712038 3:25592898-25592920 CCGTGTGATCAGAGGCATCATGG + Intronic
952998044 3:38904469-38904491 CAGCTGTAACAGAGGCAAAAGGG + Intronic
953778990 3:45849299-45849321 CAGAGGGAACATAGCAAACACGG + Intronic
955995599 3:64677434-64677456 CATTGGGTACAGAGGAAACAAGG + Intronic
956479458 3:69659503-69659525 CATTCCGCACAGAGGCAACATGG - Intergenic
957168589 3:76708334-76708356 CAGAGGGAACAGAAGCACAACGG + Intronic
958673752 3:97238809-97238831 CAGTAGGTACAAAGGCAAAAGGG + Intronic
959457164 3:106576881-106576903 CTGTGGGAAAAGAGGCATTAGGG - Intergenic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961450004 3:126998409-126998431 CTGTGGGGACACAGGCAGCAGGG - Intronic
961471460 3:127115754-127115776 GAGTGGGGACAGGGGCAAGAAGG + Intergenic
962568280 3:136686347-136686369 ATGTGGGACCAGAGACAACAAGG - Intronic
962898693 3:139738014-139738036 CTGTGGTAACAGAGGACACAGGG + Intergenic
963065879 3:141264169-141264191 CAGTGGGAAAAGAGGAAAAGAGG + Intronic
965479635 3:169201993-169202015 CATTGGAAACAGAGTCTACAGGG - Intronic
966476524 3:180354609-180354631 CTGTGGGGACAAAGGCAAAATGG - Intergenic
968563902 4:1299308-1299330 CTGTGACAACAGAGGCATCAAGG - Intronic
969082140 4:4627125-4627147 CCATGGGAAAAGAGGTAACAGGG - Intergenic
969489456 4:7490857-7490879 CAGAGGGCACAGAGGAAGCAGGG - Intronic
970403654 4:15741788-15741810 CAGTGGCAACAGAGGTTGCATGG + Intergenic
970654700 4:18218232-18218254 CAGTGAGAGCATAGGCTACAAGG - Intergenic
971182215 4:24339464-24339486 CAGTGTGAACAAAGGTAAAAAGG - Intergenic
972322360 4:37983580-37983602 CAGTGGGGACAGGGGCTATATGG - Intronic
972632053 4:40850670-40850692 TAGTTGCAACAGAGGCCACATGG + Intronic
972662865 4:41133737-41133759 CAGTGGGGAGAGAGGGACCAAGG - Intronic
973587527 4:52408379-52408401 CAGGGGGAAGAGAGGGGACAAGG + Intergenic
975558323 4:75686383-75686405 CAGTGAGAACAGAGGAAATGGGG + Intronic
975822198 4:78282974-78282996 CAGTAGAAACAGAGGAGACATGG - Intronic
976130570 4:81879603-81879625 CTGTGGGAACAGATCCTACAAGG - Intronic
976636638 4:87293001-87293023 CAGTTGGAAAAGAGGCAAGCAGG + Intergenic
979772513 4:124546152-124546174 CAGTGGGTAAAGAAGCAAGAGGG + Intergenic
980088940 4:128421371-128421393 TGGTGGAAACAGAGGCAGCAAGG + Intergenic
983205062 4:164902895-164902917 CAGTGGGAACAGGGTCAGGAGGG + Intergenic
983568014 4:169175094-169175116 GAATGGGAACGGAGGCATCATGG - Intronic
984908886 4:184653338-184653360 TAGTGGGAGAAGAGGCAGCAGGG - Intronic
985816481 5:2131803-2131825 GAGCGGAAACAGAGGCAGCATGG - Intergenic
986574455 5:9197556-9197578 CAGTTGCAACAGGGGCAAGAGGG + Intronic
986757652 5:10853320-10853342 GGGTGGGGACAGAGCCAACAAGG - Intergenic
987669254 5:20986100-20986122 TAGTTGCAACAGAGGCTACATGG + Intergenic
987754969 5:22088600-22088622 CAGGGGAAACAGAGGCCAAAAGG + Intronic
987759088 5:22135917-22135939 CAGTGAAAACAGAGTCAAGAGGG - Intronic
987955199 5:24729772-24729794 TAGAGGGAACAGAGTAAACAAGG - Intergenic
988834979 5:35023271-35023293 ACGTGGGAACAGCAGCAACAGGG + Intronic
989478007 5:41896431-41896453 AAGAGGGAACAGAGGCCAGAAGG + Intergenic
989732427 5:44664575-44664597 CAGAGGGGACTGAGGCAGCAGGG - Intergenic
990544967 5:56814459-56814481 GAGTGGGGACAGAGGGAACCCGG + Intergenic
991511001 5:67376221-67376243 CAGTGGGAACAGATGACAGATGG - Intergenic
991893800 5:71369363-71369385 CAGTGAAAACAGAGTCAAGAGGG - Intergenic
992241312 5:74772544-74772566 CAGTTGCAACAGAGGCCATATGG + Intronic
992569260 5:78038057-78038079 CGGTGGGCACAGAAGCAACCTGG + Intronic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
994139879 5:96330404-96330426 TAGTAAGAACAGAGGAAACATGG + Intergenic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
995408852 5:111832178-111832200 CAGTAGGTACAGAGGAAAAAAGG + Intronic
998131125 5:139651459-139651481 CAGTGGGAACCCATGGAACATGG - Intronic
998321916 5:141240698-141240720 TAGCGGAAACAGTGGCAACAAGG - Intergenic
999975516 5:156908333-156908355 CAGAGGGAACAGAATAAACAGGG + Intergenic
999979657 5:156945600-156945622 CAGTGGGAAGAGAGGAAGTAGGG + Intronic
1000851189 5:166341841-166341863 CAGTGGGGACAGAAGAGACAAGG + Intergenic
1001264417 5:170262541-170262563 CAGTGGGAACCGAGGCTCCTCGG - Intronic
1001957551 5:175858491-175858513 CAGCGTGAACAGATGCCACAAGG + Intronic
1002772374 6:300984-301006 CTTTGGCAACAGAGGCAGCAGGG - Intronic
1004664860 6:17740597-17740619 CAGTGGGAACTGAGGTCCCAGGG + Intergenic
1007341704 6:41194720-41194742 CAGTGGTAAAAGGGGCATCAGGG + Exonic
1007763447 6:44147602-44147624 CAGTGGGAACTGAGGCTTCAAGG - Intronic
1009198165 6:60712044-60712066 CTGTGGGAGCACAGACAACATGG - Intergenic
1011943733 6:92874513-92874535 CATTGGGAGCCAAGGCAACATGG + Intergenic
1015769581 6:136754826-136754848 CAGATGGAACAGAGGAAACGGGG + Intronic
1016505994 6:144779615-144779637 CAGGGGTAACAGAGGCAGAAAGG + Intronic
1019012450 6:168852596-168852618 CAGGGGCAGCAGAGTCAACAGGG + Intergenic
1019994963 7:4718053-4718075 TGGTGGGAACACGGGCAACAGGG - Intronic
1020223135 7:6256821-6256843 CAGAGGGAGCAGAGTCCACATGG - Intronic
1021123245 7:16820793-16820815 CAGTGGTAGCCTAGGCAACACGG - Intronic
1021159772 7:17258638-17258660 CAGAGGGAACAGACCCAACCAGG - Intergenic
1021445742 7:20731752-20731774 CAATGGCAAGAGAAGCAACAGGG - Intronic
1022798609 7:33753437-33753459 CAGTGGGCAAAGAGGCAGGAGGG - Intergenic
1023086010 7:36570938-36570960 CATGGGGAACAGAAGCCACATGG - Intronic
1023689539 7:42772193-42772215 CAGTGGGAATGGAGGCAGCAAGG - Intergenic
1026166124 7:67911325-67911347 CAGTGCCAGCAGAGGCACCAAGG - Intergenic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1027255150 7:76426265-76426287 CAGTGGGGAAAGAGGCTGCAAGG + Intronic
1028443428 7:90891022-90891044 CAGTGGGAAAATAAGCATCAAGG + Intronic
1029114114 7:98228690-98228712 CAGTAGGAACAGAGGGACCCTGG + Intronic
1029420454 7:100469333-100469355 CACTGGGAAGAGGAGCAACAGGG + Intronic
1029712464 7:102307226-102307248 CAGAGGGCACAAAGGCATCAAGG + Intronic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1029864934 7:103617938-103617960 CAGTGGGTACAGAGATGACATGG - Intronic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1030580322 7:111347120-111347142 CAGAGAGAACAGAGGCAGAAAGG + Intronic
1031186839 7:118492527-118492549 CAGTTGGAAGAGAGGCAGAAAGG - Intergenic
1033014777 7:137661217-137661239 CAGTAGGAAAAGAGCCAGCATGG + Intronic
1033246345 7:139719435-139719457 CAGAGAGAACAGAGTCAAAACGG - Intronic
1035385620 7:158470702-158470724 CAGTGGGAGGTGAGGCAAGAGGG + Intronic
1035636973 8:1155007-1155029 GAGTGGGAACAGAAGCAGGATGG - Intergenic
1036066115 8:5383379-5383401 CAGTGGGAAAGGAGACGACAAGG + Intergenic
1037150183 8:15626770-15626792 CAGAGGGGACTGAGGCAGCAGGG - Intronic
1037821593 8:22137726-22137748 CAGTGGGAGCACAGGCAGGAGGG - Intergenic
1038061378 8:23917598-23917620 CAGTGACAACAGAGGAAACAAGG - Intergenic
1038492410 8:27980585-27980607 GAGGGGGTACAGAGGCACCAGGG - Intronic
1038950159 8:32405123-32405145 AAGGTGGACCAGAGGCAACAGGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039603267 8:38859857-38859879 CAGTTGTAACAGAGGCCATATGG + Intergenic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040547062 8:48406951-48406973 CAGAGGGAACGGAGCCTACAGGG + Intergenic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1041159055 8:55018583-55018605 CAGTGTGAGCGGAGGCCACATGG + Intergenic
1041682010 8:60603510-60603532 GAGGGGGAAAAGAGGCAACGTGG + Intronic
1042051614 8:64715646-64715668 CACTGGCAACAGAGGGAAAATGG + Intronic
1042937782 8:74077804-74077826 CATTGGTAAAAGAGGTAACATGG + Intergenic
1043132029 8:76473406-76473428 ATATGGGAACAGAGGCAAGATGG - Intergenic
1043720731 8:83544914-83544936 CAGTGGGAACAGAGACTAGTGGG - Intergenic
1044118119 8:88359604-88359626 CAATGAGAAAAGAGGCAAAATGG - Intergenic
1045873315 8:106950137-106950159 CAGAGGGGACCGAGGCAGCAGGG - Intergenic
1046090438 8:109497386-109497408 CAGTGGGAACAAAGGCAGGGAGG - Intronic
1046617643 8:116495080-116495102 CAGTGGGAGAAGAGGGTACAAGG - Intergenic
1047826678 8:128583880-128583902 CAGTTGCAACAGAGGCCTCAAGG - Intergenic
1047963506 8:130028129-130028151 CAGTGGGGACTGGGGCAAAAAGG + Intergenic
1049130198 8:140832680-140832702 CTGTGGACAAAGAGGCAACAGGG + Intronic
1049207602 8:141370718-141370740 CAGTGGGAACCAAGGAAACTGGG + Intergenic
1049399187 8:142417292-142417314 CAGTGGGAACAGGGTCTTCATGG - Intergenic
1049581175 8:143411747-143411769 CAGTAGAGACAGAGGCCACAGGG + Intergenic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1049838203 8:144753981-144754003 CAGTGGGGCCACTGGCAACAGGG + Intronic
1049851971 8:144837472-144837494 CAGAGGGGACAGAGGCACCAAGG + Exonic
1052420811 9:28241404-28241426 CAGTGGTAACCGAGGTATCAGGG + Intronic
1053172766 9:35902479-35902501 CAATGGGAAAAGAAGAAACATGG + Intergenic
1053381323 9:37651349-37651371 GAGTGGAAACAGCGGCAACGCGG + Intronic
1054942850 9:70762858-70762880 TGGTGTAAACAGAGGCAACATGG - Intronic
1055770295 9:79709707-79709729 CAATGAGCACAGAGGCAAAAAGG - Intronic
1056275742 9:84992437-84992459 CACTGGTATCAGAGGCTACAAGG - Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056751322 9:89353494-89353516 CACTGGGCAAAGAGGCAACTCGG - Intronic
1059283582 9:113154433-113154455 CAGTTTGAACAGAGGCAGCAAGG - Intronic
1061077290 9:128349363-128349385 CTGTGGGAACTGAGGCTCCAAGG - Intronic
1061630021 9:131866445-131866467 CAGGGGGAAGAGAGGCGACAGGG - Intronic
1062006181 9:134239622-134239644 CAGTGGGAACACAGGCGGGATGG - Intergenic
1062109087 9:134772386-134772408 GAGTGGGGACAGGGCCAACAAGG - Intronic
1062342126 9:136098410-136098432 CAGTGGGAACAGCGGGTGCAAGG - Intergenic
1062580194 9:137225985-137226007 CAGTGGCAGCAGTGGCAGCAGGG - Exonic
1187028229 X:15457932-15457954 TAGTGGCAACAGAGGCCATATGG + Intronic
1187359417 X:18610872-18610894 TAGTGGGAAGTTAGGCAACATGG - Intronic
1187722804 X:22169639-22169661 CTGGAGGAACAGAGGCATCAGGG + Intronic
1189187394 X:39065921-39065943 CAGTGGGAAGTGAGCCACCAGGG - Intergenic
1189249698 X:39590917-39590939 CACTGGGGACAGCTGCAACATGG + Intergenic
1190728735 X:53210393-53210415 CAGTGAGTACCCAGGCAACAGGG - Exonic
1190931950 X:54956282-54956304 CAGGGAGAACAGAGGTATCAAGG + Intronic
1192982962 X:76366848-76366870 CAGTGGCAGCAGTGGCAGCATGG + Intergenic
1193635413 X:83944090-83944112 CACTGTGAGCAGATGCAACAAGG + Intergenic
1195769454 X:108334360-108334382 CAGTGGGCACACAGACATCAGGG + Intronic
1198274488 X:135088185-135088207 CAGTGGGAGGAGAGCCAATAGGG + Intergenic
1198659741 X:138955311-138955333 CGGAGGGAACACAGGAAACATGG - Intronic
1199145814 X:144365452-144365474 CAGTTGCAACAGAGACCACATGG + Intergenic
1199780295 X:151052129-151052151 CACTAGGAACAGTGGCATCAAGG - Intergenic
1200569002 Y:4804342-4804364 CTGAGGGGACAGAGGCAAGAAGG - Intergenic
1201455880 Y:14166354-14166376 CAGTGGGAACATAGAACACAGGG + Intergenic
1201502968 Y:14665711-14665733 GCTTGAGAACAGAGGCAACAGGG + Intronic