ID: 1040700898

View in Genome Browser
Species Human (GRCh38)
Location 8:50064388-50064410
Sequence CAAGGTAAGCAGAAGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 299}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040700898 Original CRISPR CAAGGTAAGCAGAAGGAGAT GGG (reversed) Intronic
901469546 1:9446744-9446766 CAAGGTAGGAAGAAGGGGAAGGG - Intergenic
901840132 1:11949144-11949166 CAACTTCAGCAGAAGGAGACAGG + Intronic
902570899 1:17346526-17346548 CAGACTAAGCAGGAGGAGATGGG - Intronic
903284218 1:22267096-22267118 CCAGGTAGGCGGAAGGAGTTGGG + Intergenic
903965291 1:27084961-27084983 CAAAGTAGGAAGAAGCAGATGGG - Intergenic
904941740 1:34168424-34168446 CCAGGTAAGCAATGGGAGATAGG + Intronic
905287407 1:36890526-36890548 CAAGGCAAGGAGAAGCAGGTGGG + Intronic
906375876 1:45296258-45296280 CAAGGTATGTATTAGGAGATGGG + Intronic
906771781 1:48491542-48491564 CAGGCTGAGCAGAAAGAGATAGG + Intergenic
906808557 1:48803365-48803387 CACTGTAGGCAGAGGGAGATTGG - Intronic
907559282 1:55373978-55374000 CATGCTCAGCAGAAGGAGTTTGG + Intergenic
908269520 1:62409529-62409551 CAAGGTTAACAAAAGGAGATGGG + Intergenic
908958788 1:69670234-69670256 CAAGGTATTCAAAAGGACATGGG + Intronic
910519048 1:88097006-88097028 CCAGGAAAGGAGAGGGAGATGGG - Intergenic
911122130 1:94307117-94307139 CAAGCATAGCAGAAGGAGAAAGG - Intergenic
914232129 1:145772820-145772842 CATGGTAAGGAGAGGGAGAAAGG - Intronic
915556549 1:156664043-156664065 GAAAGAAAGCAGAAGGAGAGGGG + Intergenic
915599711 1:156914528-156914550 CAAGGCAAAGAGAAGCAGATGGG - Intronic
915877480 1:159627033-159627055 CAAAGTAAGCAGAAGGTGATTGG - Intergenic
916208868 1:162342161-162342183 TAAGCGAAGCAGGAGGAGATGGG - Intronic
916549682 1:165838208-165838230 CAAAGAAAGAAGAGGGAGATGGG - Intronic
917679513 1:177351487-177351509 CAAAGTAAGCAGAAACAGCTCGG + Intergenic
917792984 1:178511752-178511774 CAAAATTAGCAGAAGGAGGTGGG + Intergenic
919676385 1:200387718-200387740 CAGAGTAAGAAAAAGGAGATGGG + Intergenic
920081695 1:203379512-203379534 CAAGGACAGAAGAAGGAGATGGG - Intergenic
921803855 1:219432386-219432408 GAAGGTAAGTGGAAAGAGATGGG + Intergenic
921847179 1:219896589-219896611 GAAGGGAAGAAGAAGGAGAATGG + Intronic
921964168 1:221070277-221070299 TGAAGTAAGCAGAAGGAGTTTGG + Intergenic
921992508 1:221382771-221382793 GGAGGTAAGCAGAAGGATGTTGG - Intergenic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
1063022571 10:2144361-2144383 CAAGAGAAGAAGAAGAAGATTGG - Intergenic
1065041567 10:21703048-21703070 CAAAGTAAGAAGAAAGAGAAAGG - Intronic
1065752728 10:28902527-28902549 CAATGGAAGGAGAAGGAGATAGG + Intergenic
1068534778 10:58229866-58229888 CCAGGGAAGCACAAGGAGTTGGG + Intronic
1069026179 10:63544648-63544670 GAAGGTACACAGAAGCAGATGGG + Intronic
1069102159 10:64335378-64335400 CAAGGCAAGGAAAAGGAGAAGGG + Intergenic
1069948372 10:72002618-72002640 TGAGGGAAGCAGAAGGAGCTAGG - Intronic
1070160038 10:73860928-73860950 CAAGGTGACCACAAGGAGAATGG - Intronic
1072617513 10:97059535-97059557 CAAGGTGAGCAGAAGGAGAGGGG + Intronic
1073206352 10:101771346-101771368 CAAGGTAGGCAGAAGGCCACAGG - Intronic
1076465169 10:130675530-130675552 CAAAGTAAACAGTAGTAGATGGG - Intergenic
1080474508 11:32577090-32577112 CAAGGTAGGAAGAAGGGGAAAGG + Intergenic
1080914829 11:36646324-36646346 CAAGGAAAGCAGCAAGAGACAGG - Intronic
1081440171 11:43072160-43072182 CAAGATACTCAGAAGGAGAAAGG + Intergenic
1081884578 11:46483902-46483924 AAAGGTAAAAAGAAGGAGGTAGG + Intronic
1084010077 11:66342943-66342965 AAGAGGAAGCAGAAGGAGATGGG - Intronic
1085919101 11:80930321-80930343 AAAAGGAAGCAGAGGGAGATTGG + Intergenic
1089649084 11:119900512-119900534 GGAGATAAGCAGGAGGAGATGGG - Intergenic
1091067362 11:132528458-132528480 CAAGGGAACCAGAAGGACAGTGG - Intronic
1093916259 12:24805554-24805576 CCAGGCAAGCTGAAGGAGGTAGG + Intergenic
1095511867 12:42959817-42959839 GAAGATAAGCAGAAGAAGAGAGG - Intergenic
1096609851 12:52793985-52794007 GAAGGTAAGGAGAGGGAAATGGG + Intronic
1096677513 12:53233576-53233598 CAAAGTCAGGTGAAGGAGATGGG + Intergenic
1097182985 12:57181359-57181381 CAAGGTAAGAAGAGGAAGGTGGG - Intronic
1097594866 12:61616658-61616680 CAGGCAAAGGAGAAGGAGATTGG - Intergenic
1097959032 12:65514566-65514588 CAAGTTAAGTTGAAGGAGAGAGG - Intergenic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1099893552 12:88617922-88617944 GAATGTAAGCAGTAGGAGGTCGG + Intergenic
1100384853 12:94096313-94096335 CAAAGTAGGCAGAAGAAGATGGG - Intergenic
1101986502 12:109451495-109451517 CAAGGGAAGCAGAAGGGGCCCGG + Exonic
1102624471 12:114223982-114224004 CAACGTAAGCAAAAGCAGAGAGG + Intergenic
1102665721 12:114571136-114571158 CAAGGTTTTCAGAAGGAGCTTGG - Intergenic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1106175725 13:27329601-27329623 CAAGGGAAGCAGAAGGATCTAGG - Intergenic
1106312100 13:28563318-28563340 CCAGGTGAGGAGCAGGAGATGGG + Intergenic
1106766301 13:32917121-32917143 CAAAGCAAGCAAAAGGGGATTGG - Intergenic
1106791396 13:33158459-33158481 CCAGGTAGGCAGATGAAGATGGG - Intronic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108405473 13:50096522-50096544 AAAGGTAAGAAGAAGAAGAAAGG - Intronic
1109662915 13:65488970-65488992 CAAGCTGAGCAGAAGGAGATTGG + Intergenic
1110119309 13:71864429-71864451 CAAGGAGACCAGAAGGACATTGG - Intronic
1113050656 13:106207839-106207861 CAAGTGAATCAGAAGCAGATGGG - Intergenic
1115917209 14:38329306-38329328 GAAGGGAAGAAGAAGGAGAAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117732447 14:58736940-58736962 CAAGGTAATCAGAGAGAGACCGG + Intergenic
1117859288 14:60073331-60073353 GAAGGCAAGCAGAAGCAGGTGGG + Intergenic
1117881593 14:60318049-60318071 CAAGGTAAGGAGCAGAAGGTGGG - Intergenic
1118492513 14:66274915-66274937 CAAGGAAAGAAGGAGGAGTTAGG + Intergenic
1118704544 14:68468706-68468728 CAAGATAACCAGAAGGAGTCAGG - Intronic
1120133264 14:80832674-80832696 CAAGCAAAGGAGAAGGAGTTGGG + Intronic
1121291676 14:92780658-92780680 CAAGGGAAGGAGAAAGAGCTAGG + Intergenic
1122823143 14:104357038-104357060 CAAGGAAAGCCGAGGGAGATTGG + Intergenic
1124075398 15:26439107-26439129 CCTGGTAAGGAGAGGGAGATGGG - Intergenic
1124678578 15:31709535-31709557 CCAGGGAACCAGGAGGAGATGGG + Intronic
1126386913 15:48102895-48102917 AAAGATAAGCAGAAGTTGATAGG - Intergenic
1127055275 15:55125198-55125220 CAAGCTAACAACAAGGAGATTGG + Intergenic
1127576649 15:60298360-60298382 GAAGGAAAGGAGAAGGAAATAGG + Intergenic
1127700485 15:61495265-61495287 GAAGGTAAGCAGAATGTAATTGG + Intergenic
1127780704 15:62312262-62312284 CAAAGTAAACATAAGCAGATGGG + Intergenic
1128575581 15:68772275-68772297 CAAGGTCATCAGTGGGAGATGGG - Intergenic
1129324926 15:74794816-74794838 CATGGAGAGCAGAAGGAGCTGGG - Intronic
1129532086 15:76275881-76275903 CAATGTAAGAAACAGGAGATAGG - Intronic
1130181500 15:81633923-81633945 AGAGGGAGGCAGAAGGAGATTGG + Intergenic
1130679933 15:85987848-85987870 CCAGGTTAGAAGAAGGAAATGGG + Intergenic
1131809501 15:96158172-96158194 CAAGGAAAGCTGGAGGAGAAAGG + Intergenic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1133376871 16:5294442-5294464 GAAGGTAAGCAGAAAGGCATAGG - Intergenic
1134605798 16:15570276-15570298 CCAGGTTAGCAGAAAGAGACTGG + Intronic
1134905431 16:17975899-17975921 GGAGGTAAGGAGAAGCAGATGGG - Intergenic
1135230390 16:20700976-20700998 GGAGGTAAGCAGACGGATATGGG + Intronic
1138626541 16:58256449-58256471 CCAGGTAAGGAGAATGACATGGG + Intronic
1138650644 16:58459062-58459084 GAAGATCAGCAGATGGAGATGGG - Intergenic
1139506537 16:67400778-67400800 GAAGGTGAGGAGAAGGTGATTGG - Intronic
1139918815 16:70445909-70445931 AAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1140092549 16:71850217-71850239 CAAGGTTGGCAGAAGGAGATAGG - Exonic
1140449946 16:75062915-75062937 CCAGGTGAGCAAAAGGAGCTGGG - Intronic
1140857967 16:78994358-78994380 TAAAGAAAGAAGAAGGAGATAGG + Intronic
1142140362 16:88470074-88470096 CAAAGCAAGCAGAAGGAAAAAGG + Intronic
1148294045 17:46484311-46484333 CAAAGAAACCAGAACGAGATTGG - Intergenic
1148316228 17:46702014-46702036 CAAAGAAACCAGAACGAGATTGG - Intronic
1149381445 17:56098059-56098081 AGAGAGAAGCAGAAGGAGATTGG + Intergenic
1149459367 17:56814526-56814548 CAAGGGAAGAGGCAGGAGATGGG + Intronic
1151378712 17:73710098-73710120 CAAGGTCTGCAGATGGAGCTTGG - Intergenic
1151637439 17:75360675-75360697 CAAGGTGAGCAGGAGCAGCTGGG - Intronic
1151706828 17:75773643-75773665 CCAGGGAAGGAGAGGGAGATGGG - Intergenic
1151988095 17:77556884-77556906 CACGGTTAGCTGAAGGACATTGG - Intergenic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1154166300 18:12017027-12017049 CAAGGGAAGCAGAAAGAGAGAGG - Intronic
1155637948 18:27977326-27977348 CAAGGTAAGAAAAAAGATATCGG + Intronic
1155898837 18:31362716-31362738 GAAGGAAAGCAGCAGGAGGTAGG + Intergenic
1157193509 18:45600710-45600732 CAAGGGAGGCAGCAGGAGGTAGG + Intronic
1158772425 18:60535692-60535714 GAAGGTAAGCTGAAGAACATAGG - Intergenic
1159250191 18:65865951-65865973 CAAGGTGAGGAGGTGGAGATGGG + Intronic
1159909786 18:74134864-74134886 CTAGGTAAGGAGACGGAGAGTGG - Intronic
1160215965 18:76931806-76931828 CAAGGTGAAGAGAACGAGATAGG - Intronic
1164974641 19:32563222-32563244 CAAGGTCAGCAGTTCGAGATCGG + Intergenic
1166629691 19:44394963-44394985 CAATGTAGGAAGAAGGAGTTAGG + Intronic
925575152 2:5352502-5352524 CAAGGAACCCAGAAGGAGAAAGG + Intergenic
926556839 2:14367519-14367541 GAAGTCAAGTAGAAGGAGATAGG + Intergenic
926730315 2:16031166-16031188 CAAGGTAAGGGGAAGTAGCTGGG - Intergenic
927073067 2:19549632-19549654 CGAGGTAAGCAGAGTGAGAGAGG + Intergenic
927924769 2:27003778-27003800 TTAGGTAAGGAGAAGGGGATGGG - Intronic
928854169 2:35784320-35784342 CAAGTAAAGCAGAAGTAGAATGG - Intergenic
929099566 2:38297797-38297819 CAAGGTAAGGAAAAGAAGTTTGG - Intronic
929818054 2:45251613-45251635 CAATGAAAGGAGAAGGAGGTTGG - Intergenic
932299977 2:70659835-70659857 CAAGGCAGGCAGGAGGAGAGAGG - Exonic
933727201 2:85433702-85433724 CAAGGGAAGCAGATGGAGCCAGG - Intronic
933982912 2:87568124-87568146 CAAGAGAAGCCTAAGGAGATGGG + Intergenic
934139155 2:89028729-89028751 GAAGGAAAGCAGCAGGACATGGG - Intergenic
934512486 2:94956967-94956989 CAGGGGGAGCAGAAGGAAATGGG - Intergenic
934991401 2:98924513-98924535 AAAGCTGAGCAGAGGGAGATGGG - Intronic
936310928 2:111382670-111382692 CAAGAGAAGCCTAAGGAGATGGG - Intergenic
936822077 2:116534387-116534409 AGATGTAAGCAGAAGGAGTTAGG - Intergenic
938404720 2:131024968-131024990 CAAGGTTAGCAGAAGGCCCTTGG + Intronic
938622275 2:133068460-133068482 CAAAGGAAGCAGAAGGCAATGGG + Intronic
939006433 2:136792789-136792811 CAGGATAGGCAGTAGGAGATAGG - Intronic
939176253 2:138751037-138751059 CAGGGTAATGAGAAAGAGATGGG - Intronic
939201385 2:139039729-139039751 TTAGGTAAGAAGAAGGAGATAGG + Intergenic
939631619 2:144532935-144532957 GAAGGTAATCAGAATTAGATGGG - Intergenic
940124453 2:150309098-150309120 CAAGGGAAGCAGAGAGTGATTGG + Intergenic
941088985 2:161152338-161152360 AAATGAAAGCAGAAGGAGCTTGG - Intronic
941747585 2:169103487-169103509 CCAGGTTAGCAGAAGGCGCTGGG + Intergenic
941774057 2:169372695-169372717 CAAGAGAAGCTTAAGGAGATAGG - Intergenic
941836000 2:170021550-170021572 CAAGGTTAGTATAAGGAGGTGGG - Intronic
942415554 2:175755370-175755392 GAAGGAAAGCAGAAGGGGACTGG - Intergenic
942473411 2:176287122-176287144 AAAGGTACACATAAGGAGATAGG + Intronic
942989484 2:182182344-182182366 GAGGGTAAGCAAAAAGAGATTGG - Intronic
943678465 2:190741994-190742016 CAAGGCAAGCAGAACAAGAAAGG + Intergenic
944525115 2:200611177-200611199 CAAGGAAAACAAAAAGAGATGGG + Intronic
946224632 2:218257621-218257643 CAAGCTAAGGATAAGGAGCTTGG + Intergenic
947074837 2:226331224-226331246 CAAGAAAAGCTGAAGGAGAAAGG + Intergenic
947112624 2:226735327-226735349 TATTGTAAACAGAAGGAGATGGG - Exonic
947669764 2:231928790-231928812 CAAGGAAAGCAAAGGGAGAGGGG - Intergenic
1169017934 20:2306850-2306872 CAAGGTTGGCAGGAGGAGAGGGG + Intronic
1169431432 20:5539742-5539764 CAAGGTTAGGAGAATGAGAAGGG + Intergenic
1169648792 20:7843746-7843768 CAAGGGAGTCAGAAGGAGTTGGG - Intergenic
1170641929 20:18162112-18162134 CCAGAGAAGGAGAAGGAGATGGG - Exonic
1170872066 20:20214877-20214899 CAGGGCAGGCAGAAGGAGAGTGG + Intronic
1171092403 20:22297456-22297478 AAAGGTATGCAGAAGAAGAGAGG + Intergenic
1171998472 20:31752239-31752261 CAAGGCAAGAAGAAGGATAAAGG + Intronic
1172846475 20:37932447-37932469 CAAGGCAAGCAGGAGGAGCAGGG + Intronic
1174013658 20:47470806-47470828 CAAGGTTAGCAGGATGAGAGGGG - Intergenic
1176922808 21:14708772-14708794 CAAGGCAAGGAGAAGGTGACTGG - Intergenic
1178692598 21:34761818-34761840 CAAGGTCTGCAGAAGGAGTCAGG - Intergenic
1178759286 21:35385270-35385292 CAAGGAGAGCAGAAGGAGAGAGG + Intronic
1179156624 21:38857053-38857075 CAAGGTTAGCAGATGGGGAGAGG - Intergenic
1179346688 21:40564921-40564943 CAAGGTGAGCACCTGGAGATTGG + Intronic
1179778878 21:43686872-43686894 CAAGGAAAGCATAAGAAGAAAGG + Exonic
1182144485 22:27988847-27988869 CATGGCAGGCAGAAGCAGATGGG - Intronic
1182464602 22:30506509-30506531 CAAGGTCAGGGGAAGGAGCTTGG - Intergenic
1183380288 22:37487272-37487294 CAGGGTGAGTAGCAGGAGATGGG - Intergenic
1184252569 22:43269109-43269131 CCAGGCAAGCAGACGGAGGTTGG + Intronic
1184290953 22:43498008-43498030 GCAGGTAAGCAGAAGGAGAGAGG + Intronic
949493504 3:4610902-4610924 GAAGGGAAGGAGAAGGAGAAGGG - Intronic
949601251 3:5600264-5600286 GAAGTTAAGCTGAAGGGGATGGG + Intergenic
950769631 3:15301224-15301246 CTAGGTAAGCAGATGGAGAGTGG - Intronic
951756872 3:26100489-26100511 CAAAGTAAGAAAAAGGAAATGGG + Intergenic
951914082 3:27781140-27781162 CAAGAGAAGCACAAGGAGACAGG + Intergenic
952231826 3:31439345-31439367 CAAGGTTAGCAAAGGGAGCTTGG - Intergenic
952276894 3:31886023-31886045 GAAAGAAAGGAGAAGGAGATGGG + Intronic
953472691 3:43180504-43180526 CCAGGTGAGCAGAAACAGATTGG - Intergenic
954652336 3:52172683-52172705 CAAGGAGAGGAGAAGGAGCTGGG + Intergenic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
956223749 3:66933344-66933366 CAAGGTAAGCAGAAGGGACAAGG - Intergenic
956752082 3:72351477-72351499 CAAGTTAAGCAAAAAGAGAAAGG + Intergenic
960445526 3:117744529-117744551 AAAGGGAAGCAGACGGGGATTGG + Intergenic
961097719 3:124172239-124172261 CAAGGTAAGGCGAAGGGGAATGG - Intronic
961105202 3:124234940-124234962 CAAGGTAAGGGGAAGGGGAATGG + Exonic
961262685 3:125615326-125615348 CAAAGCAGGCAGAAGAAGATGGG + Intergenic
965196272 3:165599621-165599643 CAAGCTAGGCAGAAAGAGATAGG - Intergenic
965379595 3:167971884-167971906 CAAGTTAAGCAGTAAGAGAGAGG + Intergenic
966809789 3:183833361-183833383 CAACGGAAGCAGAAGCAGGTGGG - Intronic
967009071 3:185414556-185414578 CAAGGATAGCAGAAGGACTTTGG + Intronic
968971187 4:3796073-3796095 AAAGGTGGGCAGAAGGAGAAGGG - Intergenic
970225158 4:13850080-13850102 CAAGGTTTGCAGCAGGAGAAAGG - Intergenic
970609344 4:17710823-17710845 ACAGGTAAGCAGAAGAAAATCGG + Intronic
970873232 4:20840826-20840848 AAAGTTGAGCGGAAGGAGATGGG - Intronic
975083209 4:70305368-70305390 CAATGTAACAAGAAGTAGATAGG + Intergenic
976051830 4:81018967-81018989 CCAGGTAAGTAGATGCAGATAGG + Intergenic
976563946 4:86532443-86532465 TATGGAATGCAGAAGGAGATAGG - Intronic
977228521 4:94423766-94423788 CTAGGTTTGCAGAAGGAGTTAGG - Intergenic
977235894 4:94506883-94506905 CAAAGCAGGCAGAAGAAGATGGG + Intronic
977747647 4:100569468-100569490 CAGGGCAAGCAGAGGGAGATGGG - Intronic
977967935 4:103177307-103177329 TAAGGTAAGAACCAGGAGATGGG - Intronic
981142339 4:141283032-141283054 GAAGGTAAGCAGATGGTGAATGG - Intergenic
981908416 4:149950668-149950690 GAAGGAAAGCAGCAGGAGTTGGG + Intergenic
983810015 4:172050196-172050218 CAAGGTTTGCAGCAGGAGAAAGG + Intronic
985030414 4:185783650-185783672 CGGGGTAAGCAGAAGTAGACTGG + Intronic
985583757 5:715486-715508 CAAGGAAAGAAGAAGTAAATTGG - Intronic
985597264 5:799783-799805 CAAGGAAAGAAGAAGTAAATTGG - Intronic
986427360 5:7647481-7647503 CATGGAAAGCAGGTGGAGATGGG - Intronic
991414559 5:66379141-66379163 CATTGTAGGCAGAAGGAGAGGGG + Intergenic
993016184 5:82536940-82536962 CAAAGTAAGGCGATGGAGATTGG + Intergenic
993824099 5:92659774-92659796 CATGGTAAGTAGACAGAGATAGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994606691 5:101976267-101976289 CAAGGTAAAGAGAAGGATAATGG + Intergenic
995279810 5:110321070-110321092 AAATATAAGCAGAATGAGATTGG + Intronic
995375598 5:111470987-111471009 CAGGCTAAGCAAAAGCAGATTGG - Intronic
997436724 5:133880984-133881006 CACTTAAAGCAGAAGGAGATGGG - Intergenic
997881968 5:137599711-137599733 CAAGGTGGGTAGGAGGAGATAGG + Intergenic
998119184 5:139561812-139561834 CAAGGTAAGCGGCCGGAGGTCGG + Exonic
998355104 5:141528777-141528799 CAAGGTAATCTCTAGGAGATTGG + Exonic
998360561 5:141582665-141582687 CAAGGCAAGCAGCAATAGATGGG - Intronic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
998689222 5:144569150-144569172 GGAGGTAAGAAGAAAGAGATTGG - Intergenic
999182598 5:149680755-149680777 CCAGGCAGGCAAAAGGAGATGGG + Intergenic
1000075513 5:157781423-157781445 AAAGGTCAACAGCAGGAGATGGG - Intergenic
1000606565 5:163333855-163333877 CAAGGAAAGAGAAAGGAGATAGG - Intergenic
1000865158 5:166504606-166504628 AAAAGAAAGGAGAAGGAGATTGG - Intergenic
1001260985 5:170228309-170228331 TAAAGTGAGAAGAAGGAGATGGG - Intergenic
1003127002 6:3363512-3363534 CAAGGTGAGCAGCAGGCCATGGG - Intronic
1003528258 6:6916540-6916562 GAAGGAAAGCAGAAGGAGGCAGG + Intergenic
1004491621 6:16122629-16122651 CAGGGTAAGGAGAAGCAGACTGG + Intergenic
1005493257 6:26366744-26366766 CAAGGTCTGCAGATGGAGGTGGG - Intronic
1005502502 6:26442122-26442144 CAAGGTCTGCAGAGGGAGGTGGG - Intronic
1007070577 6:39035115-39035137 CATGGTAACCAGAAGGAGCATGG + Intergenic
1007377450 6:41466573-41466595 GAGGGAAAGGAGAAGGAGATAGG + Intergenic
1010022064 6:71171872-71171894 CAAGGCAAGCAGAAGGAAGAAGG - Intergenic
1010602544 6:77848391-77848413 CATGGGAAGCAGAAGGAAAGAGG + Intronic
1013364278 6:109424083-109424105 CAAGGTAAGGAGTAGGAGGGTGG + Intronic
1013639517 6:112059541-112059563 CAAGGTAATCACAAGTACATTGG - Intronic
1014109792 6:117607779-117607801 CATGGTGAGCAGAGGGAGTTAGG + Intergenic
1014698919 6:124658814-124658836 CTAGGAAGGAAGAAGGAGATAGG - Intronic
1015185896 6:130415159-130415181 CAAGGGAAGCAGAAGGAAAGGGG + Intronic
1015255832 6:131178729-131178751 CAGGTCAAACAGAAGGAGATAGG - Intronic
1016789164 6:148049937-148049959 CAAAGCATGCAGAAGAAGATGGG + Intergenic
1017529294 6:155272484-155272506 GAAGGCAAGCAGAAGCAGAGGGG - Intronic
1018950177 6:168373984-168374006 CCAGGGAAGGAGAAGGAGCTGGG + Intergenic
1019402104 7:861180-861202 CAAGGCCATCAGATGGAGATGGG - Intronic
1021972239 7:25976754-25976776 AAAGGTAAGCAGAAGTCTATTGG - Intergenic
1022267707 7:28773683-28773705 CAGGGAAAGCAGAAAGATATGGG - Intronic
1022778647 7:33554963-33554985 CAAGGTCAGCAGATGGAGCAAGG + Intronic
1024429241 7:49266770-49266792 CAAGGTAAGGATAAGGTCATGGG - Intergenic
1024450934 7:49542291-49542313 GAACTGAAGCAGAAGGAGATGGG + Intergenic
1024747832 7:52428430-52428452 CATGGTAAGGAGAAGGACAGGGG - Intergenic
1028210577 7:88069240-88069262 GAAGGAAAGCAGAAGGAGAGAGG - Intronic
1029806387 7:103001620-103001642 CAAAGCAGGCAGAAGGAGGTGGG + Intronic
1032555129 7:132824793-132824815 TAAGGTAAGAAGAGGGAGAATGG - Intronic
1032842333 7:135724168-135724190 CAAGTTAAGGGGAAGGAGGTGGG + Intronic
1033948773 7:146757912-146757934 CAATGTAATCAGAAGTAAATAGG - Intronic
1034450538 7:151134912-151134934 CAAGGTTGGCATATGGAGATAGG + Intronic
1038376643 8:27046724-27046746 CAAGTGAAGCAGAAATAGATTGG + Intergenic
1039098406 8:33912823-33912845 GAAGGTGAGAAGATGGAGATGGG - Intergenic
1039266638 8:35831687-35831709 AAAGGTAAGCAGTAGGAATTTGG - Intergenic
1039825774 8:41173040-41173062 CAAGGTCACCAGAAGGACGTGGG - Intergenic
1040700898 8:50064388-50064410 CAAGGTAAGCAGAAGGAGATGGG - Intronic
1040867239 8:52060393-52060415 CATAGTAGGCAGAAGTAGATTGG - Intergenic
1040911066 8:52519709-52519731 CAGAGTAAGTAGCAGGAGATGGG - Intergenic
1042056840 8:64772928-64772950 CAAAGTGAGAAGGAGGAGATGGG - Intronic
1043472147 8:80573645-80573667 GAAGGTGAGTAGAAGGAGAATGG - Intergenic
1044743523 8:95351123-95351145 CATGGGCAGCATAAGGAGATTGG + Intergenic
1046240370 8:111482783-111482805 CAAGGTCAGGAGATCGAGATCGG - Intergenic
1046721478 8:117624350-117624372 CAAGCCAAGCTGCAGGAGATAGG + Intergenic
1047122220 8:121917905-121917927 TAATGTAAGCAGAAGCAGACAGG + Intergenic
1047303461 8:123634702-123634724 TCAGGAAAGCAGAGGGAGATCGG - Intergenic
1047586129 8:126275144-126275166 CAATGGATGGAGAAGGAGATGGG - Intergenic
1047719716 8:127628386-127628408 CACGGTGAGCAGAAGGATCTAGG - Intergenic
1048888881 8:138930887-138930909 GAAGGAAAGAAGAAGGAGAGGGG + Intergenic
1049231245 8:141484296-141484318 TAAGGTAAGAAAAAGGAGAAGGG - Intergenic
1049492726 8:142913756-142913778 CAATGGAAGCAGAGGGAGCTGGG - Intronic
1049622323 8:143604258-143604280 CAGGGTCAGCCTAAGGAGATGGG - Exonic
1050527758 9:6560917-6560939 AGAGGGAAGCAGAGGGAGATGGG + Intronic
1050727619 9:8669545-8669567 CAAGGTTAGTGGAAGGAAATAGG + Intronic
1051132850 9:13882001-13882023 CAAGGGAAGCAGAAAGAAAAGGG + Intergenic
1051251745 9:15166340-15166362 CATTGTAAGCAGAAGGGAATGGG + Exonic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052849952 9:33372021-33372043 GAAGGTAAACAGCAGGAGACAGG + Intergenic
1053609394 9:39696442-39696464 CCAGGCAAGAAGAATGAGATAGG - Intergenic
1053867235 9:42452712-42452734 CCAGGCAAGAAGAATGAGATAGG - Intergenic
1054088921 9:60775046-60775068 CCAGGCAAGAAGAATGAGATAGG + Intergenic
1054244130 9:62645955-62645977 CCAGGCAAGAAGAATGAGATAGG + Intergenic
1054558255 9:66680503-66680525 CCAGGCAAGAAGAATGAGATAGG + Intergenic
1057874649 9:98744473-98744495 CAAGGTAAGTGTAAGGACATCGG + Intronic
1060322996 9:122583324-122583346 CAAGAGAAGCCGAAGGAGACAGG + Intergenic
1060527198 9:124327312-124327334 CAGGGCGAGGAGAAGGAGATTGG - Intronic
1185868679 X:3645174-3645196 CCAGGTGAGCAAAAGGAGACAGG - Intronic
1185943118 X:4343461-4343483 CAAGGTAAAAAGAAAGAAATTGG - Intergenic
1186599890 X:11025091-11025113 GAAGGTGAGCAGAAGCAGAGTGG - Intergenic
1186710738 X:12193577-12193599 CAACTTATGCAGAAGAAGATAGG - Intronic
1186966184 X:14788520-14788542 CAAGGTTAGAAGGAGGAGAAGGG - Intergenic
1187576216 X:20559140-20559162 GAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1187576224 X:20559173-20559195 CAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1187997671 X:24946199-24946221 CAAGGTAAGTAGAAGAGGACAGG - Intronic
1189578194 X:42377657-42377679 CAAGGGAAGCAGAATGAAAAAGG - Intergenic
1191093058 X:56644488-56644510 CAAGATGAACAGAAGGAAATTGG - Intergenic
1192030284 X:67503946-67503968 CAAGGTAACCACAAAGAGAAAGG + Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1194143022 X:90228621-90228643 AGAGGCAAGCAGAAGGAGAAGGG - Intergenic
1196055112 X:111347451-111347473 CAAGGCAAGCCAAAGGAAATCGG - Intronic
1198013258 X:132581767-132581789 CAAAGTAAGTAGAAGGTGAAAGG - Intergenic
1198151405 X:133913958-133913980 CAAGGGAAGCAGGAGGTGATTGG - Intronic
1198378266 X:136060725-136060747 GAAGGTAAGGAGAGGGAGAAAGG + Intergenic
1200488775 Y:3797940-3797962 AGAGGCAAGCAGAAGGAGAAGGG - Intergenic
1200795484 Y:7337598-7337620 CCAGGTGAGCAAAAGGAGATAGG + Intergenic
1201916206 Y:19184042-19184064 AGAGGGAAGGAGAAGGAGATAGG - Intergenic