ID: 1040700948

View in Genome Browser
Species Human (GRCh38)
Location 8:50064760-50064782
Sequence CAGAATTATAAGAAGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 314}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040700948_1040700951 6 Left 1040700948 8:50064760-50064782 CCTGGCTCCTTCTTATAATTCTG 0: 1
1: 0
2: 2
3: 23
4: 314
Right 1040700951 8:50064789-50064811 GCTCCCCTGCTAGCTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040700948 Original CRISPR CAGAATTATAAGAAGGAGCC AGG (reversed) Intronic
900606767 1:3527172-3527194 CAGAGTTTTAGGATGGAGCCTGG - Intronic
901583604 1:10267177-10267199 CAAAAATACAAAAAGGAGCCAGG - Intronic
902858565 1:19227569-19227591 CAGAACTAGAAAAATGAGCCAGG + Intronic
904529468 1:31158775-31158797 CAGGAGTTTAAGAAGCAGCCTGG + Intergenic
905338120 1:37259446-37259468 GATGATTCTAAGAAGGAGCCAGG - Intergenic
905397366 1:37675463-37675485 GAAAATGATAAGAAGGGGCCAGG + Intergenic
908333449 1:63095798-63095820 CAGAATTGTAAGAATTAGGCTGG - Intergenic
908806480 1:67937920-67937942 CAGAAGGACAGGAAGGAGCCAGG - Intergenic
908814924 1:68021978-68022000 CAAAATAATAACAAGAAGCCAGG + Intergenic
910009222 1:82439876-82439898 AAGAAGTATGAGAAGGAGCAGGG + Intergenic
911054779 1:93700351-93700373 CAAAATTATAAAAATTAGCCAGG - Intronic
912167110 1:107055093-107055115 GAGAATTCTAATAAGCAGCCAGG + Intergenic
913386239 1:118261079-118261101 CAGAATTATAATAATGATGCAGG - Intergenic
913705739 1:121420714-121420736 TAGAAAAATGAGAAGGAGCCAGG + Intergenic
914325129 1:146606246-146606268 CAGAATTCTAAGTAGAAGACAGG + Intergenic
915576468 1:156781920-156781942 CAGAATTATAGGAAGAAGAATGG + Intronic
915657549 1:157374199-157374221 AATAATTAAAAGAAGTAGCCGGG + Intergenic
918081333 1:181209932-181209954 CGGAATTAGAGGAATGAGCCTGG - Intergenic
918132499 1:181642033-181642055 CAAAATAATAAGAGGGAGCAGGG + Intronic
919354018 1:196498428-196498450 CAGAATTAGAAGAAAGAGGGAGG - Intronic
919596079 1:199563914-199563936 CAATATTATAAGAAGTAGCAGGG + Intergenic
920913293 1:210237154-210237176 CAGAATATTAAACAGGAGCCAGG - Intronic
921430421 1:215058858-215058880 CAGGATGACAAGAAGGAGTCTGG - Intronic
923280689 1:232440306-232440328 TGGAATCATAAGAACGAGCCAGG + Intronic
923709370 1:236373499-236373521 CAGAAATGTAAGAAGGAGCTGGG - Intronic
924722073 1:246633286-246633308 CAAAAATACAAAAAGGAGCCGGG + Intronic
1063687753 10:8254815-8254837 CAGAATTCCATGAAAGAGCCAGG + Intergenic
1065647113 10:27846987-27847009 CAGAAGTACAAGGAGGAGCGGGG + Intronic
1065648282 10:27860290-27860312 CAAAATTAAAAGAATTAGCCAGG + Intronic
1065649507 10:27872933-27872955 CAGAAGTACAAGGAGGAGCGGGG - Intronic
1065797419 10:29319940-29319962 AAGAATTAAAAGAATTAGCCAGG + Intergenic
1065940920 10:30563302-30563324 CACAATTATTGGATGGAGCCCGG + Intergenic
1066073235 10:31843535-31843557 AATAATTAAAAGTAGGAGCCTGG - Exonic
1067466065 10:46500126-46500148 CTGGATTATGAGAAGGAGCAGGG + Intergenic
1067621123 10:47884480-47884502 CTGGATTATGAGAAGGAGCAGGG - Intergenic
1068924244 10:62518277-62518299 AAAAATTATTAGAATGAGCCTGG - Intronic
1068944899 10:62719942-62719964 CAGAATTTTAAAAATGAGCTGGG + Intergenic
1071120705 10:82274352-82274374 CAGAATTAGAAGAAGGTTGCAGG - Intronic
1071800906 10:89058849-89058871 AAGAAATATAGGAAGGAGCTGGG + Intergenic
1072431261 10:95373115-95373137 CAGATTTATTACAAAGAGCCTGG - Intronic
1072776601 10:98202689-98202711 TAAAATTATAAAAATGAGCCAGG + Intronic
1074411951 10:113236012-113236034 CAGAAATACAAAAAGTAGCCGGG + Intergenic
1074650160 10:115513164-115513186 CAGTTTTATTAGAAGGGGCCTGG + Intronic
1075049611 10:119173231-119173253 AAGAATTAGAAAAAGCAGCCGGG - Intronic
1076156176 10:128207232-128207254 CAGAATTCCAAGAATGGGCCTGG + Intergenic
1078129032 11:8596651-8596673 CTGAATGATGAGAAGGAACCAGG - Intergenic
1078448738 11:11424688-11424710 CAGCAGGATAAGGAGGAGCCAGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079880844 11:25924172-25924194 CTCACTTATAAGAAGGAGCTAGG - Intergenic
1081910740 11:46698298-46698320 CAGGATTAGAAGGAGCAGCCGGG + Intronic
1082079438 11:48000707-48000729 CTGAGTGATAAGAAGGAGCGAGG - Intronic
1083568049 11:63737127-63737149 CGGAATTCTAAGATGGAGCTGGG - Intronic
1085426557 11:76409900-76409922 GAGACTTATAAGAATGAGCAGGG - Intronic
1085654427 11:78299888-78299910 CAGAATTAAAAGAATGACCCTGG + Intronic
1087271616 11:96117803-96117825 CAGAGTTATAAGAAGAAGCCTGG + Intronic
1088478993 11:110275189-110275211 CAGAATTTTAAGATGGCCCCTGG + Intronic
1089330655 11:117686683-117686705 CAGAATTTTAAGGAAGAGGCAGG + Intronic
1090183885 11:124723651-124723673 CAGAATCACAAGAAGGTTCCTGG + Intergenic
1090745215 11:129699838-129699860 CAGAAGTGGCAGAAGGAGCCGGG - Intergenic
1091158069 11:133392473-133392495 CAGAATCCTAAGAAGAAGGCTGG + Intronic
1092034458 12:5319520-5319542 CAAAAATATAAGAATGAGCCAGG + Intergenic
1092691546 12:11116561-11116583 AAGAATTTCAAGAATGAGCCTGG - Intronic
1093275000 12:17115024-17115046 AAGAATTAAAAGAAGGAGCTTGG + Intergenic
1093923237 12:24883123-24883145 CAAAAATATAAAAATGAGCCAGG + Intronic
1095191099 12:39258926-39258948 CTGAATTAGAACAAGGAGTCTGG + Intergenic
1095673778 12:44892272-44892294 CAGAATTGGAAGTAGAAGCCTGG - Intronic
1096130581 12:49155829-49155851 CAGAATGAAAAGAACAAGCCAGG + Intergenic
1096488457 12:52000028-52000050 GAGAATTCTCAGAAGGACCCAGG - Intergenic
1096754174 12:53785104-53785126 CAAAATTAGAAGCAGGAGCTGGG - Intergenic
1096848133 12:54419011-54419033 GAGAATCCGAAGAAGGAGCCCGG + Exonic
1097073258 12:56372282-56372304 TAAAATCATAAGAAGTAGCCGGG - Intergenic
1098246408 12:68523422-68523444 AAAAATTATAAGAAGAAGCAGGG - Intergenic
1098788819 12:74794200-74794222 CAGCATAATAGGAAGGAGCTGGG + Intergenic
1100732697 12:97490142-97490164 GAGAAATAGAAGAATGAGCCTGG + Intergenic
1101533217 12:105593942-105593964 GAGAATTTTAAGGAGGATCCAGG - Intergenic
1102356514 12:112241353-112241375 CAGAGTTCTGACAAGGAGCCTGG + Intronic
1102783094 12:115582664-115582686 ATGAATTATAAGAGGGAGGCTGG + Intergenic
1110995853 13:82108519-82108541 TATAATTATAAGCAGGATCCTGG + Intergenic
1111512115 13:89279722-89279744 CAGAAATACAAGAAGGAGATTGG + Intergenic
1113532853 13:111042070-111042092 AAGTATTATAGGAAGGACCCAGG - Intergenic
1114274020 14:21125520-21125542 CAAAACTATAAAAAGAAGCCAGG + Intergenic
1116439940 14:44939831-44939853 AAGAATTTTAAGTAGGAGTCTGG - Intronic
1116935399 14:50734390-50734412 CAGAATTATAAGAAGAAATGGGG - Intronic
1118337238 14:64864086-64864108 CAGAATTATAAGCAGCACCATGG - Intronic
1118886891 14:69874929-69874951 GAGAAATAATAGAAGGAGCCTGG + Intronic
1119215881 14:72868715-72868737 CAGAATGACAGGAAGGAGCGAGG + Intronic
1119868860 14:77995867-77995889 CAAAAATATAAAAAGTAGCCGGG + Intergenic
1120453250 14:84698382-84698404 AAGAATTTTAAGAAGGAGCAAGG - Intergenic
1120860127 14:89247494-89247516 CAGAATTATGATAAGGGGACAGG + Intronic
1121141539 14:91546927-91546949 TAAAATTATAAAAAGGAGCCCGG + Intergenic
1121522543 14:94596151-94596173 CACAATGATAAGAGTGAGCCTGG + Intronic
1121819968 14:96958355-96958377 GAAAATGATAAGCAGGAGCCTGG - Intergenic
1122248871 14:100424282-100424304 CAGAAGTCTAACAAGGAGCAGGG + Intronic
1122352478 14:101104061-101104083 CAGAAGGCTAAGCAGGAGCCAGG + Intergenic
1124369856 15:29098474-29098496 CAGAATTCTAAGAAGGACAGTGG - Exonic
1124627178 15:31314819-31314841 CAGAATTCTAAGATGGCCCCAGG - Intergenic
1126053344 15:44707395-44707417 CTGAATAATCAGAAGTAGCCAGG - Intronic
1126303202 15:47223060-47223082 CAGGAGTATAAGATGGAACCTGG - Intronic
1126336053 15:47587322-47587344 CAGAAATGTAAGATGGAGCCAGG - Intronic
1126410088 15:48364576-48364598 TAGAATGATAGGCAGGAGCCAGG + Intergenic
1126849838 15:52790220-52790242 CAGAATTTTAAGAAAGAGAGGGG - Intronic
1127333612 15:57962879-57962901 GAGAATTTTCAGAAGGAACCTGG - Intronic
1129411211 15:75351436-75351458 CAAAAATTTAAGAAGTAGCCAGG - Intronic
1130349467 15:83078477-83078499 TAGATTTATAGGAAGGAGCCGGG - Intergenic
1131776138 15:95800935-95800957 CAGAAAGATGAGAAGGAGCATGG + Intergenic
1131786852 15:95922605-95922627 CAGAATTACAGGAAGTGGCCAGG - Intergenic
1134466504 16:14483478-14483500 CAGAGTAATAAGAAGGACCCTGG - Intronic
1134857995 16:17536784-17536806 CTGAATGAGAAGAGGGAGCCAGG + Intergenic
1135486315 16:22868667-22868689 CAGAATTGTAAGATAGAGCACGG - Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137830311 16:51537921-51537943 CTGAATTAGAAGGAGGAGTCTGG - Intergenic
1138907025 16:61349309-61349331 CTGAAATAAATGAAGGAGCCAGG - Intergenic
1139260244 16:65585332-65585354 CAAAAATATAAAAAGTAGCCGGG - Intergenic
1139457614 16:67094918-67094940 CAGAATTTTAAGAAAGAGGCCGG + Intronic
1140008436 16:71104701-71104723 CAGAATTCTAAGTAGAAGACAGG - Intronic
1141930343 16:87198005-87198027 TAGAAATATAAAAAGTAGCCAGG + Intronic
1142645213 17:1307290-1307312 CACCATTAAAAGAAGGAGGCCGG + Intergenic
1143575994 17:7793387-7793409 CAGAATCCCACGAAGGAGCCAGG - Intronic
1144866980 17:18342473-18342495 CAAAAATATAAGAATTAGCCGGG - Intronic
1146019858 17:29268196-29268218 AAGAATTATAAGAGCCAGCCGGG - Intronic
1146685784 17:34840821-34840843 AAAAAATCTAAGAAGGAGCCGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148976766 17:51536636-51536658 CACAATTATAACAAGTACCCAGG + Intergenic
1149259380 17:54862359-54862381 AAGAATTCTAAGAAGGAATCTGG + Intergenic
1150215669 17:63467573-63467595 CAGAGTTAACAGAAGCAGCCGGG + Intergenic
1150332459 17:64305236-64305258 CAAAATTAAAAAAAGGAGGCGGG - Intergenic
1150905866 17:69336512-69336534 GAGAATCCTAAGAAAGAGCCAGG + Intergenic
1151924709 17:77186467-77186489 CAGAAGGATAAGCAGGTGCCAGG - Intronic
1153443507 18:5147201-5147223 CAGAAGGAAAAGAAGGAGCTTGG + Intronic
1153592310 18:6686579-6686601 CAGAGTGACAGGAAGGAGCCAGG + Intergenic
1153835971 18:8964315-8964337 AAGAATTGAAAGCAGGAGCCTGG + Intergenic
1154964345 18:21341666-21341688 AAAAATTATAATAAGTAGCCAGG - Intronic
1155039775 18:22055304-22055326 TGGAATTATAAGCATGAGCCTGG - Intergenic
1155214291 18:23629463-23629485 CAGCATTATCAGCAGGGGCCAGG + Intronic
1155706117 18:28815453-28815475 CAGAATTATAAAAAGTGCCCTGG + Intergenic
1156104763 18:33646862-33646884 CAGAATTTTAAGGGGGAGCGGGG + Intronic
1156228333 18:35130557-35130579 CAGAATTATTAGAAGGAGAGAGG + Intronic
1156418370 18:36923290-36923312 CAGGATTATAATAAGGATCATGG + Intronic
1156433990 18:37106577-37106599 CAAAAATACAAAAAGGAGCCAGG - Intronic
1157392220 18:47312395-47312417 CAGAATGACAAGCAGCAGCCTGG + Intergenic
1158596525 18:58821463-58821485 CAAAATTAAAAGCAGGAACCAGG + Intergenic
1159583948 18:70265074-70265096 CTGAATTCTAAGAAGGAGAAAGG - Intergenic
1159678607 18:71318365-71318387 CAAAAATATAAAAAGTAGCCAGG + Intergenic
1160355845 18:78227769-78227791 CAGAAATATAAAAACTAGCCAGG + Intergenic
1161639777 19:5414469-5414491 CAGAATTATAAGATGAAGAATGG - Intergenic
1162487366 19:10969405-10969427 AAGAAATATAAAAAGGCGCCAGG - Intronic
1163164648 19:15487559-15487581 AAGAATTAAAAAAAAGAGCCAGG - Intronic
1163461323 19:17439525-17439547 CAAAAATATAAAAAGTAGCCAGG + Intronic
1164791841 19:30992782-30992804 CAAAATTACAAAAAGTAGCCAGG - Intergenic
1165882574 19:39054001-39054023 CAGAATAATAAGCAGTGGCCAGG - Intergenic
1166017306 19:39992174-39992196 CAGAATTATGACAAAGAGACAGG - Intronic
1166780486 19:45340122-45340144 TAGAAATATAAAAAGTAGCCGGG + Intronic
1166949329 19:46416113-46416135 CAAAAATATAAGAATTAGCCGGG + Intergenic
926643518 2:15263517-15263539 CAGAAAGATAGGAAGGGGCCTGG - Intronic
927394358 2:22632346-22632368 TAGAATTAGAATAAGCAGCCTGG + Intergenic
929205931 2:39292960-39292982 CAGAATTAAAACAAGGAACTGGG + Intronic
929447287 2:42011349-42011371 TAAAAATATAAGAAGCAGCCGGG - Intergenic
931006776 2:57858700-57858722 CAAAATTACAAAAAGTAGCCAGG + Intergenic
932454143 2:71835488-71835510 CACAATTACAAGAAGAAACCTGG - Intergenic
933040394 2:77457825-77457847 CATGATGATAAGAAGGTGCCAGG - Intronic
933315431 2:80708630-80708652 CTAAAATATAAGAAGCAGCCAGG - Intergenic
935568713 2:104636388-104636410 CAAAGTGATAAGAAGGACCCAGG - Intergenic
935665459 2:105508265-105508287 CTGAATTATAAGCAGGACCTAGG - Intergenic
936432854 2:112480172-112480194 CAAAAATATAAAAAGTAGCCAGG + Intergenic
937101192 2:119270764-119270786 AAGAATTGTAAGAAGGAGCAGGG + Intergenic
937549791 2:123073680-123073702 TAGAAATAACAGAAGGAGCCAGG - Intergenic
937685116 2:124687264-124687286 CTGCATTATAAGAGGGAGTCTGG + Intronic
940608386 2:155957912-155957934 CAGTATTATAAACAGGAACCAGG - Intergenic
941419579 2:165265979-165266001 CAGAAATGTAATAAAGAGCCAGG - Intronic
941991457 2:171561242-171561264 CAGAATTAGAAGAAGGAAAAAGG - Intergenic
943682654 2:190784694-190784716 CAGAATTCTAAGATGGCCCCCGG + Intergenic
945256822 2:207810144-207810166 CAGAATTTCAAGATGGAGACAGG + Intergenic
945547806 2:211178947-211178969 CAGAATCATAACAAGGAACATGG - Intergenic
947783267 2:232790168-232790190 CAGAATTACAAGTGGGAACCTGG + Intronic
1169442981 20:5648473-5648495 CAAAAATATAAAAAGTAGCCGGG + Intergenic
1169684793 20:8259453-8259475 TAAAAATATAAGAAGTAGCCAGG + Intronic
1172057129 20:32161960-32161982 CCCAATAATAAGAGGGAGCCAGG + Intronic
1172754525 20:37273907-37273929 CAGAATTAGAAAAAGAGGCCAGG + Intergenic
1173111960 20:40199424-40199446 CAGAAATATAAGGAGGAGACAGG - Intergenic
1173597501 20:44268659-44268681 CTGAAGGATGAGAAGGAGCCTGG + Intronic
1174039847 20:47691375-47691397 CTGAATGATGAGAAGGAGCTGGG + Intronic
1174052546 20:47777213-47777235 CCGAAGCATAGGAAGGAGCCAGG + Intronic
1174394681 20:50239655-50239677 TAGAATGATGAGAAGGAGCTGGG + Intergenic
1174502486 20:50995931-50995953 AAAAAATATAAAAAGGAGCCAGG - Intergenic
1174759868 20:53196515-53196537 CGGAATTATAGGAAGGACTCTGG + Intronic
1175312556 20:58021681-58021703 CAGAATGATAGGCAGGGGCCGGG + Intergenic
1175380095 20:58556970-58556992 ATGAATGACAAGAAGGAGCCAGG + Intergenic
1175471618 20:59233975-59233997 CAGAAGTAGAAGAAGCAGACAGG - Intronic
1177778774 21:25600233-25600255 CAGAAATATAAAAATTAGCCGGG + Intronic
1177885588 21:26741987-26742009 CAGTCTTATAAAAATGAGCCTGG + Intergenic
1178675376 21:34627013-34627035 TATAATTATAAGAAGGTGGCTGG - Intergenic
1179220813 21:39405352-39405374 AAAAATTATAAGAATTAGCCAGG - Intronic
1180133589 21:45844770-45844792 CAGATTCATAAGAAGAAGACTGG + Intronic
1181027674 22:20135237-20135259 CAGAAACATAGGAAGGGGCCGGG - Intronic
1181624809 22:24116052-24116074 GAGAATTAAAGGAAGGAGGCTGG - Intronic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1183137612 22:35904144-35904166 CTAAAAGATAAGAAGGAGCCTGG - Intronic
950491173 3:13305908-13305930 CAGAACTAGAAGCAGAAGCCTGG + Intergenic
951463026 3:22971219-22971241 CAGAATGACAAGAAATAGCCAGG + Intergenic
951601201 3:24377729-24377751 CAGCTTTTTAACAAGGAGCCAGG - Intronic
951864634 3:27294408-27294430 CAAAATGACATGAAGGAGCCAGG + Intronic
956814796 3:72898507-72898529 CAGAATTCTATGAAGGCACCTGG - Intronic
957285048 3:78207408-78207430 CAGAATTAGAAGGTGGGGCCTGG + Intergenic
957422903 3:79994860-79994882 CAGAAATATCAGAAGGAGCATGG - Intergenic
957971418 3:87387878-87387900 CAAAGTCATAAGAAGGAGCAGGG + Intergenic
959130137 3:102344753-102344775 CTAAATGACAAGAAGGAGCCTGG + Intronic
959801665 3:110502421-110502443 TAAAAATATAAAAAGGAGCCGGG - Intergenic
961028268 3:123580313-123580335 CAAAAATATAAAAATGAGCCAGG + Intronic
961128249 3:124441527-124441549 AAAAAGTATAAGGAGGAGCCAGG + Intronic
961156749 3:124686082-124686104 AAGAAGCATAAGAAGGAGGCAGG + Intronic
961259482 3:125589186-125589208 CAAAAATATAAGAATTAGCCGGG + Intronic
962005796 3:131348417-131348439 AAGAACTATGAGAAGGAGCCTGG + Intronic
962156321 3:132952449-132952471 AAGAAATATCAGAAAGAGCCTGG - Intergenic
962805778 3:138926262-138926284 CAGACTTCTAAGAAAGAGTCTGG + Intergenic
962959847 3:140300616-140300638 AAGAATAATAAGTAGGAGCTAGG + Intronic
964068875 3:152608220-152608242 TAGAATTAGAATAATGAGCCGGG + Intergenic
964396492 3:156251357-156251379 CAGAAATATATGAAGGATTCAGG + Intronic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
964935341 3:162078050-162078072 CAAATTAATAAAAAGGAGCCTGG - Intergenic
965566389 3:170123185-170123207 CATAATAATAAGGAAGAGCCTGG - Intronic
965570276 3:170165454-170165476 CAGAATTATATGATGAAGGCTGG + Intronic
966796085 3:183714815-183714837 CAGACTTTTCAAAAGGAGCCTGG - Intronic
967422781 3:189292539-189292561 CAGAAATAACAGAAGGATCCTGG + Intronic
968120001 3:196119528-196119550 AAGAATGATTAGAAGGAGGCTGG + Intergenic
968209671 3:196838317-196838339 AAGAATTATTACAGGGAGCCAGG - Intergenic
968982957 4:3860615-3860637 CAGCATTGCAGGAAGGAGCCTGG - Intergenic
969107322 4:4817501-4817523 CAGAATGATGCGCAGGAGCCAGG - Intergenic
970127904 4:12834908-12834930 GAAAATTATGAGAAGGAGGCCGG - Intergenic
971191086 4:24429810-24429832 CAAAAATATAAAAAGTAGCCAGG - Intergenic
971311995 4:25533095-25533117 CAGAATGACAAGAATGGGCCGGG - Intergenic
971835943 4:31762804-31762826 AGGATTTATAAGAAGGAGGCAGG - Intergenic
971863194 4:32136224-32136246 CTGAAGGATGAGAAGGAGCCAGG + Intergenic
972863567 4:43202232-43202254 CAGAATTTTAAAAATGAGCTAGG - Intergenic
973098902 4:46237098-46237120 TAGCATTATAAGATGGAGCATGG + Intergenic
973842809 4:54879706-54879728 CAGAATTCTGAGAAGGATCCTGG + Intergenic
974000938 4:56510061-56510083 TAGAATTATAAGAGGGAGGCTGG + Intronic
975116923 4:70690006-70690028 CAAAATTAGAAGAAGAGGCCAGG + Exonic
975208200 4:71668433-71668455 CAAAAATATAAAAAGTAGCCAGG - Intergenic
976932839 4:90590111-90590133 CAAAATTATAAAAATTAGCCAGG + Intronic
977540416 4:98312224-98312246 CAGAATTATTAGCTGGAGACTGG - Intronic
979817293 4:125125568-125125590 CTGAATAATAAGAAAAAGCCAGG + Intergenic
980476508 4:133324463-133324485 AAGAATTAAAAGTAGGGGCCAGG - Intergenic
981160191 4:141488254-141488276 CACAATTAGAACAAGGAGGCCGG - Intergenic
981291730 4:143084248-143084270 AAGAATGGTAAGGAGGAGCCAGG - Intergenic
981340084 4:143611531-143611553 CAGAAATATGAGAAGGAACAGGG + Intronic
986541663 5:8851021-8851043 AAGAAAAATAAGAAGCAGCCCGG - Intergenic
986664589 5:10089356-10089378 CAGAATTCTAAGATGGCCCCAGG - Intergenic
988612868 5:32744377-32744399 AAGAATTGTAAGAGGCAGCCAGG - Intronic
992691896 5:79248602-79248624 TATAATTATAAGAAGGAGGCCGG - Intronic
994952834 5:106487197-106487219 CAAAATTATAAGAAAGAGAAAGG - Intergenic
995790779 5:115883933-115883955 TAGAATTCTAAGAAAGAACCGGG - Intronic
997960812 5:138320009-138320031 AAGAATTAAAAGCAGGGGCCGGG + Intronic
998020871 5:138769185-138769207 CAGGAAAACAAGAAGGAGCCAGG - Intronic
998737554 5:145159837-145159859 CAGAGATATAAGAAGAAACCAGG - Intergenic
999836392 5:155377791-155377813 CAGAGGTACAAGGAGGAGCCGGG - Intergenic
1000863205 5:166481409-166481431 AAGCATTATAATAATGAGCCTGG - Intergenic
1001073125 5:168604153-168604175 CAGAAGTAGACCAAGGAGCCGGG + Intergenic
1003692269 6:8366473-8366495 CAGAAGGATAAGTAGGAGCTAGG + Intergenic
1004267671 6:14163250-14163272 GAGAATTACATGCAGGAGCCAGG + Intergenic
1006063844 6:31446438-31446460 TAAAAATATAAAAAGGAGCCAGG - Intergenic
1006781399 6:36634890-36634912 CACAACCACAAGAAGGAGCCAGG + Intergenic
1007009884 6:38406178-38406200 AAGATTTATAAGAAGGTGCTAGG - Intronic
1008675291 6:53812392-53812414 CAGAATTTGAAGAAAGAGGCCGG + Intronic
1011987447 6:93466551-93466573 CTGAATTATTACAAAGAGCCAGG + Intergenic
1012839819 6:104316036-104316058 CAAACTTATAAGAAGTAGGCAGG + Intergenic
1013091656 6:106905808-106905830 CAAAAATACAAGAATGAGCCTGG + Intergenic
1014894095 6:126879938-126879960 GAGAATTATATCAAGGTGCCTGG - Intergenic
1017441792 6:154471375-154471397 TAAAATTATAAAAAGTAGCCAGG + Intronic
1017924115 6:158896105-158896127 TAAAACTATAAAAAGGAGCCAGG - Intronic
1018302905 6:162422646-162422668 AAGAGTCATAAGAAGGAGGCTGG + Intronic
1018610112 6:165639907-165639929 GAGAATTTTAAAAATGAGCCAGG + Intronic
1020131191 7:5559430-5559452 TAAAATTACAAAAAGGAGCCCGG + Intronic
1021484972 7:21157605-21157627 CAAAAATATAAAAAGTAGCCGGG + Intergenic
1021575545 7:22102655-22102677 CAGAGCTCTCAGAAGGAGCCAGG - Intergenic
1021882184 7:25105801-25105823 CAGAATTTTAACAAGGAGACAGG + Intergenic
1022648956 7:32257578-32257600 CAGAATAATTACAAGGTGCCAGG - Intronic
1025191249 7:56897611-56897633 CAAAAATATAAAAATGAGCCGGG - Intergenic
1025680697 7:63679323-63679345 CAAAAATATAAAAATGAGCCGGG + Intergenic
1026530910 7:71196433-71196455 CAGAAGCAGAAGAAGGGGCCAGG - Intronic
1027007409 7:74707143-74707165 CAGAATTATAAACGGGGGCCGGG - Intronic
1029201103 7:98839751-98839773 CAGAAATACAAAAACGAGCCTGG + Intergenic
1029230951 7:99068110-99068132 CAGAAATATAAGAAGAAGAGAGG - Intronic
1030633001 7:111916134-111916156 CAGAACTCTAAGAGGCAGCCTGG + Intronic
1031197565 7:118635840-118635862 CTAAATTTTAAGAAGGATCCTGG + Intergenic
1031350816 7:120728584-120728606 CAAAAACATAAGAAGGAGGCTGG - Intronic
1031412867 7:121460972-121460994 CAGAAGAAAAAGAAGGAGCAGGG - Intergenic
1034386001 7:150741830-150741852 GAGAATTATTAGAAAGAGGCAGG - Intronic
1034457330 7:151177950-151177972 ATGAAAAATAAGAAGGAGCCGGG + Intronic
1035027459 7:155835381-155835403 AAGAATTATAGGAAGGAGCCAGG - Intergenic
1036141538 8:6213496-6213518 TAGAAATGAAAGAAGGAGCCAGG + Intergenic
1037314833 8:17591175-17591197 CAAAATAATCAGAAGCAGCCAGG - Intronic
1037473279 8:19231832-19231854 AAGAAATATAAGAAGAAGGCAGG - Intergenic
1038379800 8:27081885-27081907 AAGAAATTCAAGAAGGAGCCAGG + Intergenic
1039839543 8:41284156-41284178 AAGAATAATAAGAAAGAGTCTGG + Intronic
1040700948 8:50064760-50064782 CAGAATTATAAGAAGGAGCCAGG - Intronic
1041767704 8:61436632-61436654 CAGAAATATGAGAAGAATCCAGG - Intronic
1042094473 8:65198265-65198287 CAGCATTATCAGAAGGAGAAAGG - Intergenic
1042437120 8:68779502-68779524 CAGAATTAAAAGCACGAGACAGG + Intronic
1043384370 8:79733366-79733388 GAGAAGTAGAAGAGGGAGCCAGG + Intergenic
1043606197 8:82003338-82003360 CAAAGTTATAAGAAGGTGCATGG + Intergenic
1045458812 8:102409181-102409203 CAGAATGATTACAAGGTGCCTGG - Intronic
1045593005 8:103619608-103619630 CAGAACTACAAAAAGGAGGCAGG + Intronic
1046626830 8:116584246-116584268 CTGACTTACAAGAAGCAGCCAGG + Intergenic
1047104310 8:121716514-121716536 CAAAATTATAAAAATTAGCCAGG + Intergenic
1048474054 8:134727259-134727281 CTGAGTGATAAGAAGGAGCCAGG + Intergenic
1048614195 8:136056619-136056641 CTGAAGGAAAAGAAGGAGCCAGG - Intergenic
1049594849 8:143478497-143478519 CAAAAAAATAAGAAGGAGCGGGG - Intronic
1051030446 9:12668692-12668714 CAGAATTATAAAAAGCAGCTTGG - Intergenic
1051631737 9:19147182-19147204 CAGAACTATCACAAGGAGTCCGG - Intronic
1053159497 9:35804391-35804413 CAAAAATATAAAAATGAGCCGGG - Intronic
1053558866 9:39168310-39168332 AAGAATTCAAAGAAGGGGCCAGG - Intronic
1053822990 9:41988543-41988565 AAGAATTCAAAGAAGGGGCCAGG - Intronic
1054138245 9:61450633-61450655 AAGAATTCAAAGAAGGGGCCAGG + Intergenic
1054607583 9:67198823-67198845 AAGAATTCAAAGAAGGGGCCAGG + Intergenic
1055036425 9:71823166-71823188 CAGAATAATTAGATGGGGCCAGG - Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1058312357 9:103519625-103519647 AAGAATTATAAAAATGTGCCAGG - Intergenic
1058678201 9:107419353-107419375 CAGAAATATAAAAATTAGCCTGG + Intergenic
1058978499 9:110147088-110147110 CAAAAATATAAAAATGAGCCAGG + Intronic
1059475106 9:114540306-114540328 CAGAATTATGCAAAGGAGGCCGG + Intergenic
1059857556 9:118416757-118416779 TACAATTACAAGAAGAAGCCTGG + Intergenic
1061436213 9:130563818-130563840 CAGAATTCTAAGACGGCCCCCGG + Intergenic
1186880159 X:13857100-13857122 CATCCTTATAAGAAGGAGGCAGG - Intronic
1187775196 X:22748822-22748844 CAGAATGATAAGATGCAACCTGG + Intergenic
1188072623 X:25735906-25735928 CTGAATGACAAGAAGGAGCCAGG + Intergenic
1188523517 X:31063875-31063897 CAGTATTTTCAAAAGGAGCCAGG + Intergenic
1189613239 X:42759405-42759427 GAGAATTATAGAAAGGAGTCAGG + Intergenic
1189992042 X:46604591-46604613 CAGAAATACAAAAATGAGCCAGG - Intronic
1190144046 X:47874412-47874434 CAGAATTCCATGCAGGAGCCAGG + Intronic
1190730027 X:53219797-53219819 CTGACTAATAAGAAGGAGCAGGG - Intronic
1192989611 X:76435456-76435478 CAGAATTCTAAGAATGCTCCGGG + Intergenic
1194347632 X:92785597-92785619 CAGCATTTTAAGAATTAGCCTGG - Intergenic
1195288596 X:103409809-103409831 CTGAACGATAAGAAGAAGCCAGG + Intergenic
1195385930 X:104313581-104313603 AAGAATTTTAAGAATTAGCCAGG - Intergenic
1196360042 X:114842613-114842635 CAGAATGCTCAGAAGAAGCCTGG + Intronic
1196420953 X:115520621-115520643 CAGAACTACAAAAAAGAGCCCGG + Intergenic
1197290229 X:124646987-124647009 CAAAATTATAAAAAGGGCCCTGG + Intronic
1197673941 X:129309739-129309761 TAGAAATATAAGAATTAGCCAGG + Intergenic
1199934626 X:152560443-152560465 CTGAAGCATAACAAGGAGCCAGG + Intergenic
1200655958 Y:5902230-5902252 CAGCATTTTAAGAATTAGCCTGG - Intergenic