ID: 1040701828

View in Genome Browser
Species Human (GRCh38)
Location 8:50075166-50075188
Sequence GGCAGCCGGAGCCTCCCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040701819_1040701828 -2 Left 1040701819 8:50075145-50075167 CCTCCCCCCTGTGGGCTCCTGGG 0: 1
1: 1
2: 12
3: 132
4: 756
Right 1040701828 8:50075166-50075188 GGCAGCCGGAGCCTCCCCAATGG No data
1040701823_1040701828 -7 Left 1040701823 8:50075150-50075172 CCCCTGTGGGCTCCTGGGCAGCC 0: 1
1: 21
2: 113
3: 381
4: 771
Right 1040701828 8:50075166-50075188 GGCAGCCGGAGCCTCCCCAATGG No data
1040701821_1040701828 -5 Left 1040701821 8:50075148-50075170 CCCCCCTGTGGGCTCCTGGGCAG 0: 1
1: 0
2: 20
3: 132
4: 784
Right 1040701828 8:50075166-50075188 GGCAGCCGGAGCCTCCCCAATGG No data
1040701815_1040701828 6 Left 1040701815 8:50075137-50075159 CCTCTCCGCCTCCCCCCTGTGGG 0: 1
1: 0
2: 1
3: 44
4: 434
Right 1040701828 8:50075166-50075188 GGCAGCCGGAGCCTCCCCAATGG No data
1040701810_1040701828 21 Left 1040701810 8:50075122-50075144 CCTGCCATGCCCGAGCCTCTCCG 0: 1
1: 4
2: 97
3: 434
4: 1187
Right 1040701828 8:50075166-50075188 GGCAGCCGGAGCCTCCCCAATGG No data
1040701812_1040701828 12 Left 1040701812 8:50075131-50075153 CCCGAGCCTCTCCGCCTCCCCCC 0: 1
1: 1
2: 5
3: 79
4: 1136
Right 1040701828 8:50075166-50075188 GGCAGCCGGAGCCTCCCCAATGG No data
1040701822_1040701828 -6 Left 1040701822 8:50075149-50075171 CCCCCTGTGGGCTCCTGGGCAGC 0: 1
1: 1
2: 23
3: 123
4: 729
Right 1040701828 8:50075166-50075188 GGCAGCCGGAGCCTCCCCAATGG No data
1040701817_1040701828 1 Left 1040701817 8:50075142-50075164 CCGCCTCCCCCCTGTGGGCTCCT 0: 1
1: 1
2: 12
3: 125
4: 809
Right 1040701828 8:50075166-50075188 GGCAGCCGGAGCCTCCCCAATGG No data
1040701825_1040701828 -9 Left 1040701825 8:50075152-50075174 CCTGTGGGCTCCTGGGCAGCCGG 0: 1
1: 1
2: 16
3: 56
4: 316
Right 1040701828 8:50075166-50075188 GGCAGCCGGAGCCTCCCCAATGG No data
1040701813_1040701828 11 Left 1040701813 8:50075132-50075154 CCGAGCCTCTCCGCCTCCCCCCT 0: 1
1: 0
2: 0
3: 83
4: 1033
Right 1040701828 8:50075166-50075188 GGCAGCCGGAGCCTCCCCAATGG No data
1040701824_1040701828 -8 Left 1040701824 8:50075151-50075173 CCCTGTGGGCTCCTGGGCAGCCG 0: 1
1: 0
2: 3
3: 42
4: 284
Right 1040701828 8:50075166-50075188 GGCAGCCGGAGCCTCCCCAATGG No data
1040701809_1040701828 28 Left 1040701809 8:50075115-50075137 CCTGCAGCCTGCCATGCCCGAGC 0: 29
1: 225
2: 963
3: 623
4: 462
Right 1040701828 8:50075166-50075188 GGCAGCCGGAGCCTCCCCAATGG No data
1040701811_1040701828 17 Left 1040701811 8:50075126-50075148 CCATGCCCGAGCCTCTCCGCCTC 0: 1
1: 0
2: 9
3: 96
4: 690
Right 1040701828 8:50075166-50075188 GGCAGCCGGAGCCTCCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040701828 Original CRISPR GGCAGCCGGAGCCTCCCCAA TGG Intronic
No off target data available for this crispr