ID: 1040711017

View in Genome Browser
Species Human (GRCh38)
Location 8:50188829-50188851
Sequence CAGTGCAGGCCTTTAGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 1, 2: 5, 3: 20, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040711017_1040711024 29 Left 1040711017 8:50188829-50188851 CCAAATCCTAAAGGCCTGCACTG 0: 1
1: 1
2: 5
3: 20
4: 129
Right 1040711024 8:50188881-50188903 CTGACATTTCAAGTTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040711017 Original CRISPR CAGTGCAGGCCTTTAGGATT TGG (reversed) Intronic
901453034 1:9347736-9347758 CTGTGGAGGCCTATAGGGTTTGG + Intronic
902666693 1:17944401-17944423 CAGCACAGGCCCTTATGATTTGG - Intergenic
912050682 1:105524980-105525002 CAGTGGAGGCCTCTAGGGTTTGG - Intergenic
915698411 1:157767915-157767937 CAGTTCAGGACTATAGGACTGGG + Intronic
917522751 1:175761565-175761587 CACAGCAGGCCCTTAGGCTTGGG + Intergenic
918014563 1:180620581-180620603 CAGTAAAGGCCTTTCTGATTAGG + Intergenic
918626400 1:186660576-186660598 CAGTGGTGGCCTTAATGATTAGG - Intergenic
918865205 1:189887746-189887768 CAGTGAAGGCATTTGGGAATGGG + Intergenic
919398574 1:197081283-197081305 CATTACAGGCCTGGAGGATTAGG + Intergenic
920044976 1:203127341-203127363 GAGAGCAGGGTTTTAGGATTGGG + Exonic
922499659 1:226087181-226087203 CAGCACAGGCCTCTAGGGTTTGG - Intergenic
923956667 1:239030368-239030390 CAGTTCATCTCTTTAGGATTGGG + Intergenic
1064519450 10:16186107-16186129 CAGCACAGACTTTTAGGATTTGG - Intergenic
1066547969 10:36522039-36522061 CAGTACAGGCCTTTCAAATTTGG + Intronic
1068476317 10:57531169-57531191 CTGTGTAGGCCTTTAGGTTTTGG + Intergenic
1069831903 10:71286868-71286890 CGGTGCGGGCCTTTCGGAGTGGG + Exonic
1070978477 10:80624956-80624978 CAGGTGAGGGCTTTAGGATTTGG - Intronic
1071681344 10:87708554-87708576 CAGTTCAAGCCTATAGGACTTGG + Intronic
1072180976 10:92979541-92979563 CAGTGGAAACCTGTAGGATTTGG + Intronic
1073937480 10:108650898-108650920 CAGTGTAGGGCATGAGGATTTGG - Intergenic
1075711166 10:124531143-124531165 CAGGGAAGGCCTTGAGGATATGG - Intronic
1077395773 11:2320438-2320460 CAGTGAAGTCCTATAGGATATGG - Intergenic
1078551595 11:12284839-12284861 GAGAGCAGGCCTGTGGGATTGGG + Intronic
1078860573 11:15242892-15242914 AAGTGCAGGCCTCTAGAATCAGG - Intronic
1080637682 11:34138164-34138186 GAGTGCAGGCCTTGAGGAGGTGG + Intronic
1082753567 11:57048918-57048940 TAGTGGAGGCCTTTGGGATCAGG - Intergenic
1082920249 11:58485038-58485060 CAAAGCAGGCCCTTAGGATTTGG + Intergenic
1083994277 11:66264526-66264548 CAGGGCAGGCCCTCAGGCTTTGG + Intronic
1084656924 11:70525171-70525193 CAGTGCAGGCCTCGAGGACTTGG + Intronic
1085029681 11:73263466-73263488 CAGTGCAGGCCTTGTGGAGTTGG - Intergenic
1089111800 11:116063152-116063174 CAGAGCAGGCCTGCAGGATCCGG - Intergenic
1089696244 11:120218098-120218120 CAGTGGTGACCTTTGGGATTCGG + Intronic
1091231221 11:133989067-133989089 AAGTGCAGGCCTCTAGGACAGGG + Intergenic
1092598342 12:10031848-10031870 CAGTGAAGGCTCTGAGGATTGGG + Intronic
1098172815 12:67763681-67763703 CAGTGCAGGGCTTGAGTCTTTGG - Intergenic
1098606040 12:72391139-72391161 CACTGGAGGGGTTTAGGATTTGG + Intronic
1099139465 12:78953507-78953529 CGGGGCAAGACTTTAGGATTGGG - Intronic
1100213846 12:92427311-92427333 CAGTTTAAGCCTTTAGGATAAGG - Intronic
1101128684 12:101666236-101666258 GAGTGCAGGCCCTTGGGATAAGG - Intronic
1106328530 13:28717665-28717687 CAGTAAAGGCCATTAGGTTTGGG + Intronic
1106340040 13:28819586-28819608 CAGGGCAGGCCTCCAGGAATGGG - Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1109933299 13:69245234-69245256 CAGCACAGTCCTTTAGGTTTTGG - Intergenic
1111586868 13:90292673-90292695 CAGTGTGTTCCTTTAGGATTGGG - Intergenic
1111706461 13:91755475-91755497 TAATGAAGGCCTTTAGGACTTGG + Intronic
1112493785 13:99889570-99889592 CAGTACAGGAATTTAGGTTTAGG + Intronic
1112562680 13:100527872-100527894 CAGAGGAGGACGTTAGGATTGGG + Intronic
1118880781 14:69824077-69824099 CAGTGGAGGCTTCTAGGATTTGG - Intergenic
1122651563 14:103229621-103229643 CACTGCTGGCCTAGAGGATTAGG - Intergenic
1127776340 15:62267010-62267032 CAGAGCAGGCATGTGGGATTTGG - Intergenic
1129037236 15:72657925-72657947 CAGAGCAGGCATGTGGGATTTGG + Intronic
1129397748 15:75261785-75261807 CAGAGCAGGCATGTGGGATTTGG + Intronic
1129401359 15:75286062-75286084 CAGAGCAGGCATGTGGGATTTGG + Intronic
1129838724 15:78730359-78730381 CAGTGCAGGCATGTGGGATTTGG + Intergenic
1132685248 16:1159385-1159407 CAGTGCAGGCCTTGAGGTGGGGG + Intronic
1136452227 16:30359804-30359826 TGGTGTAGGCCTTCAGGATTCGG + Exonic
1137716410 16:50601068-50601090 CAGACCAGGCCTTTTGTATTTGG - Intronic
1140739952 16:77932633-77932655 CAGGACAGTCCTTTATGATTTGG + Intronic
1140818603 16:78642820-78642842 CTGTCCAGCTCTTTAGGATTAGG + Intronic
1141758236 16:86009330-86009352 CATTGGAGGCCCTTAGGATGGGG - Intergenic
1142114753 16:88350808-88350830 CAATGCAGGCCTCTAGAATTTGG + Intergenic
1146173431 17:30649966-30649988 CAGTGCAGGCCTGGAGGCCTGGG - Intergenic
1146346888 17:32065996-32066018 CAGTGCAGGCCTGGAGGCCTGGG - Intergenic
1150500343 17:65644439-65644461 TAATGCAGTCCTTGAGGATTCGG + Intronic
1158056119 18:53282851-53282873 TAGTGCAGGCCTTTAAAATTTGG - Intronic
1162051474 19:8036501-8036523 CAGTGCAGGGGTTTAGGACCAGG + Intronic
1162988991 19:14290094-14290116 CAGTGCAGGCCTGGAGGCCTGGG + Intergenic
928223436 2:29424965-29424987 CAGTGAATGCCTTTAGAATAGGG - Intronic
928771159 2:34703012-34703034 CAGTGGAGGCCTTTGGGAGACGG - Intergenic
930641204 2:53856256-53856278 CCTTGCAGGACTTTGGGATTTGG - Intronic
930939607 2:56998037-56998059 CTGTGCCAGCCTTTAGGCTTTGG - Intergenic
931333956 2:61320387-61320409 CAGTGCATGTCTTTGGGATGTGG + Intronic
935855616 2:107269706-107269728 CGAGGCAGGCCTGTAGGATTAGG + Intergenic
939061806 2:137431419-137431441 TAGTTCATCCCTTTAGGATTGGG + Intronic
940605922 2:155924349-155924371 CAGTGGAGGCCTCTAGGATTTGG - Intergenic
941660716 2:168192946-168192968 CAGTGCTGGCCCTCAGGAGTGGG - Intronic
943006888 2:182395780-182395802 CAGCAGAGGCCTCTAGGATTTGG + Intronic
943388123 2:187227076-187227098 CAGTAGAGGCCTCTAGGATTTGG + Intergenic
947867404 2:233408765-233408787 CAGTGCAGGCCTGCGGGATCAGG + Intronic
1170541832 20:17396881-17396903 CAGTGAAGGCCTCTAGGAAATGG + Intronic
1172491679 20:35344008-35344030 CAGTGCAGTCCTGCAGGAATTGG - Intronic
1175190074 20:57205794-57205816 CAGTGCTGGCCTGTAGCATCTGG - Intronic
1178060762 21:28851198-28851220 CAGTGGCAGCCTCTAGGATTTGG - Intergenic
1178485226 21:33015107-33015129 CCATGCATGCCTTTAGGCTTTGG - Intergenic
1183101766 22:35588587-35588609 CGGTGGAGGCCTTAAGCATTGGG + Intergenic
1183831419 22:40420264-40420286 CAGAGCAGGGCTTTAGGCTCTGG - Intronic
1184048615 22:41988149-41988171 CAGTGCAGGGCTCCTGGATTGGG + Intronic
953452892 3:43018836-43018858 CAGTGCAGTCTTTTGGAATTAGG + Intronic
961806459 3:129492728-129492750 CACTGCAGGCCTATTGGGTTTGG - Intronic
962387293 3:134942247-134942269 CAGTCCCAGCCTGTAGGATTGGG + Intronic
965893165 3:173540156-173540178 CAGCACAGGCCTTTAGGGTTTGG - Intronic
967525882 3:190492226-190492248 CAGTGAAGGGATTTAGGAATGGG - Intergenic
968462778 4:733560-733582 CAGTGCAGGCCCTGAGGCCTGGG - Intronic
968800176 4:2738058-2738080 CAGCGGAGGCCTGTAGGATCTGG + Intergenic
970390875 4:15612323-15612345 TGGTGCAGGCCTGCAGGATTTGG - Exonic
972726556 4:41750734-41750756 CTTTGCTGGCCTTTAGGTTTAGG - Intergenic
972927694 4:44032013-44032035 AAGTGTAGGTCTTAAGGATTGGG - Intergenic
976581381 4:86740545-86740567 CATTGCAGGCCTGGAGGTTTAGG - Intronic
980419220 4:132539426-132539448 CAGTGAAGGCCTTCAGAATTTGG + Intergenic
980599203 4:134997651-134997673 TAGTGCAGGCATTCAGGATCTGG - Intergenic
982321104 4:154078275-154078297 GAGTGCTGGCCATTAGGCTTGGG + Intergenic
982623348 4:157732962-157732984 CAGTGGAGGCCTTTAGGATTTGG - Intergenic
986037039 5:3950494-3950516 AAGTGGAGGCCTCTAGGATTTGG - Intergenic
986914461 5:12600692-12600714 CAATGCAGGCCCTTAGGACTTGG + Intergenic
987753203 5:22067676-22067698 CAGCACAGGCCCTTAGGATTTGG + Intronic
988228761 5:28448065-28448087 CAGTGGAGGCCTCTAGGATTTGG + Intergenic
996912222 5:128668914-128668936 CAGCACTGGCCTTTAGGATTTGG + Intronic
998203033 5:140140476-140140498 AAGCGCTTGCCTTTAGGATTGGG - Intergenic
1001030592 5:168259708-168259730 TTGTGCAGGCCTTTTGGACTGGG - Intronic
1002136464 5:177110866-177110888 CAGAGGAGGCCTTCAGGATCTGG + Intergenic
1003692319 6:8366828-8366850 TAGTGGTGGCCTTTAGAATTAGG + Intergenic
1004025963 6:11818838-11818860 CTATGCAGGCCTTTAGACTTTGG - Intergenic
1004298581 6:14436613-14436635 CAATGCAGGCCTTTGGATTTGGG + Intergenic
1005157379 6:22822151-22822173 CAGTGAGGGCCTGTAGGAATTGG - Intergenic
1009356404 6:62752467-62752489 CAGTGCAGGCATCTGGTATTAGG - Intergenic
1011856729 6:91702229-91702251 CAGTTCAGGACTTGAGGATCTGG - Intergenic
1016893431 6:149030180-149030202 CAGTGCTGTCCCTTAGGACTTGG - Intronic
1017025348 6:150176403-150176425 CAGTCAATGCCTTTAGGATTAGG + Intronic
1017284525 6:152658752-152658774 TAGTGCAGACCCTTGGGATTTGG - Intergenic
1024429383 7:49268842-49268864 CAGTGGAGCCTTTTAGAATTTGG + Intergenic
1025790633 7:64684128-64684150 CAGTCCAGTCCTTTCGGAGTTGG - Intronic
1026507430 7:70997239-70997261 CAGTACAGGCATGTAGGATTGGG + Intergenic
1027336156 7:77152682-77152704 CAGAGCACTCCTTTAGGCTTTGG - Intronic
1028400256 7:90417953-90417975 CACTGCAGGACTGTAGGACTTGG + Intronic
1028825763 7:95271659-95271681 CAGTACAAGACCTTAGGATTTGG + Intronic
1030136064 7:106250342-106250364 CAGTACAGGCCTTTCAAATTTGG + Exonic
1033198351 7:139346686-139346708 CAATGCAGGCCCTTAGGCTGAGG + Intronic
1037953611 8:23036041-23036063 CAGCACAGGCCCTTAGGTTTTGG + Intronic
1038854244 8:31313885-31313907 CAGAGCAGGCTTTTAGAAGTAGG + Intergenic
1039508119 8:38067040-38067062 AAGTGCAACCCTTAAGGATTAGG + Intergenic
1040672909 8:49713824-49713846 AAGTGCAGGCCTATAGACTTTGG - Intergenic
1040711017 8:50188829-50188851 CAGTGCAGGCCTTTAGGATTTGG - Intronic
1042413195 8:68488250-68488272 GAGTCAAGGCCTTTAGAATTTGG + Intronic
1044471333 8:92572326-92572348 CAGTCCAGGGCTTTAGGAATAGG + Intergenic
1044775135 8:95679065-95679087 CACTGCAGACCATTTGGATTAGG + Intergenic
1045645581 8:104293902-104293924 TTGTGCTGGCCTTGAGGATTTGG - Intergenic
1046597078 8:116273265-116273287 CATGGCAGGCCTTGAGGAATGGG + Intergenic
1049938550 9:522883-522905 CAGTGCAGGCATTTAGCTTTTGG - Intronic
1050906504 9:11012393-11012415 CAGCGCTGGCCTTAAGGATGTGG + Intergenic
1052232578 9:26172117-26172139 TAGTGAAGTCCTTTAGGATATGG - Intergenic
1052240781 9:26270945-26270967 AAGTGCTGGGATTTAGGATTAGG + Intergenic
1053024140 9:34716424-34716446 CACTGCTTGCATTTAGGATTTGG + Intergenic
1054737054 9:68764531-68764553 TACTGTAGGCCTTTAGAATTTGG + Intronic
1056171065 9:83984925-83984947 CAGTGGAGTTCTTTAGGATCAGG + Intronic
1057896038 9:98909325-98909347 CAGTGAAAGCATTTAGGAGTAGG - Intergenic
1188225901 X:27597053-27597075 CACTGAAGGCCATTTGGATTTGG + Intronic
1188575851 X:31649291-31649313 CAGTTCAGGACTGTAGGACTGGG + Intronic
1189979598 X:46495858-46495880 CAGTACAATCCATTAGGATTTGG + Intronic
1189979752 X:46497292-46497314 CAGTACAATCCATTAGGATTTGG + Intronic
1190145781 X:47890492-47890514 CAGTGCAGATCTTTAGGATTTGG - Intronic
1192238745 X:69313418-69313440 CAGCTCAGGCCTCTGGGATTTGG - Intergenic
1194589650 X:95783814-95783836 CACTGCAGACATTTAAGATTCGG + Intergenic
1195608283 X:106834767-106834789 CATTTCAGGGCTTTATGATTTGG - Intronic
1197386781 X:125812307-125812329 CAGTGAAGGCCTCTAGGATTTGG - Intergenic
1197572393 X:128165239-128165261 CAATGCATGCATTTGGGATTAGG - Intergenic
1199580341 X:149354111-149354133 CAGTGCAGGCCTTTGAGATTTGG + Intergenic