ID: 1040711677

View in Genome Browser
Species Human (GRCh38)
Location 8:50195941-50195963
Sequence CTCAAGAATCATCATCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040711677_1040711680 8 Left 1040711677 8:50195941-50195963 CCTCCATGATGATGATTCTTGAG 0: 1
1: 0
2: 1
3: 22
4: 160
Right 1040711680 8:50195972-50195994 TTAATATCAATAATTTTCATGGG No data
1040711677_1040711681 9 Left 1040711677 8:50195941-50195963 CCTCCATGATGATGATTCTTGAG 0: 1
1: 0
2: 1
3: 22
4: 160
Right 1040711681 8:50195973-50195995 TAATATCAATAATTTTCATGGGG No data
1040711677_1040711679 7 Left 1040711677 8:50195941-50195963 CCTCCATGATGATGATTCTTGAG 0: 1
1: 0
2: 1
3: 22
4: 160
Right 1040711679 8:50195971-50195993 TTTAATATCAATAATTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040711677 Original CRISPR CTCAAGAATCATCATCATGG AGG (reversed) Intronic
900484603 1:2915480-2915502 CTCAGGAATTGTCAGCATGGTGG - Intergenic
904751868 1:32745852-32745874 CTCAATAATCATCATCATCATGG - Intronic
906187928 1:43875682-43875704 CTCAGGAAACACAATCATGGCGG - Intronic
906573598 1:46867163-46867185 CTCAAGGTTAATCATCATTGTGG + Intergenic
906598265 1:47099742-47099764 CTCAAGGTTAATCATCATTGTGG - Intronic
906871575 1:49487608-49487630 CTCAGGAAACATAATCATGGTGG - Intronic
908346009 1:63233831-63233853 CTCAGGAAACATAATCATGGAGG + Intergenic
909798459 1:79774603-79774625 CTCAGGAAACATAATCATGGTGG + Intergenic
910265693 1:85334651-85334673 CTCAGGAAACCTAATCATGGTGG - Intronic
911428592 1:97754705-97754727 CTCAAGAATCTTCACAGTGGTGG + Intronic
915882835 1:159690534-159690556 CTCAAACATCATCTTCATTGCGG + Intergenic
923306860 1:232696637-232696659 CTAAAGAACAATCATCTTGGCGG + Intergenic
923410004 1:233698715-233698737 CTCAGGAAACACAATCATGGTGG + Intergenic
924544451 1:245012619-245012641 CTCAGGCATCATCTTCTTGGAGG + Intronic
1063205322 10:3825843-3825865 CTCCAGACTCATCACCAAGGTGG - Intergenic
1064627955 10:17280880-17280902 CTCAGGAAACACAATCATGGTGG + Intergenic
1066504949 10:36031566-36031588 CTCAAGATTTATCTTCAAGGTGG + Intergenic
1066997244 10:42575591-42575613 CACAAAAATCATCATAATTGTGG - Intronic
1068293237 10:55033025-55033047 CTGAAGATTTAGCATCATGGTGG - Intronic
1071197492 10:83178025-83178047 CTCAGGAAACACAATCATGGAGG + Intergenic
1075663006 10:124211223-124211245 GTCAAACATTATCATCATGGTGG - Intergenic
1079114035 11:17629255-17629277 CTCAGGACTCATGATCGTGGAGG + Exonic
1080573342 11:33576922-33576944 CTCAGGAATCATCAACATATAGG + Intronic
1081003145 11:37699734-37699756 CTAAGGAACCATAATCATGGTGG + Intergenic
1081427193 11:42938378-42938400 CTGAAGATTCACCATCATTGGGG - Intergenic
1085917698 11:80909529-80909551 CTGAAGAATGATCTTCGTGGTGG + Intergenic
1087939333 11:104076180-104076202 TTCAGGAAACATAATCATGGTGG - Intronic
1088321531 11:108559020-108559042 CTCAACGATTATCATCATGCTGG - Intronic
1089714859 11:120349156-120349178 CTCAAGAATTCTAATCATGCAGG - Intronic
1093570855 12:20664133-20664155 CTCAGGAAACATAATCATGGTGG - Intronic
1096125730 12:49118186-49118208 CTAAAGATTCTTCATCATAGTGG - Intergenic
1098850435 12:75589545-75589567 CTAAAGAATGATGATCAAGGGGG - Intergenic
1099076436 12:78114458-78114480 CTCAGGAAACAGAATCATGGTGG + Intronic
1102073012 12:110037305-110037327 CACTACTATCATCATCATGGTGG - Intronic
1102137231 12:110585546-110585568 CTGAAGTTTCATCACCATGGGGG + Intergenic
1104241973 12:126998968-126998990 CTCAAGCATCATCTCTATGGAGG - Intergenic
1107672167 13:42757420-42757442 CTCAGGAAACAGAATCATGGTGG + Intergenic
1109804839 13:67425644-67425666 CTCAGGAAACACAATCATGGTGG + Intergenic
1111409071 13:87850860-87850882 CTCAAGAAGGATGATGATGGAGG + Intergenic
1112688447 13:101860740-101860762 CTCAAGAATCATAATTTTGAGGG - Intronic
1113013102 13:105793419-105793441 CTCAGGAAACATATTCATGGCGG + Intergenic
1114246565 14:20919918-20919940 CTCAACAATTGTCATCATAGTGG + Intergenic
1114780576 14:25534008-25534030 CTCAGGAAACACAATCATGGTGG + Intergenic
1115505140 14:34086616-34086638 CTCAGGAAACACAATCATGGAGG + Intronic
1116020729 14:39457312-39457334 ATAAAGAATTATAATCATGGTGG + Intergenic
1116713219 14:48396312-48396334 CTCAGGAAACTTAATCATGGTGG - Intergenic
1116794644 14:49376697-49376719 CTCAAGAATCATGCTGAAGGAGG - Intergenic
1120771260 14:88382967-88382989 CTCAGGAAACACTATCATGGTGG - Intergenic
1124110189 15:26778087-26778109 CTCAGGAAACATAATCACGGCGG + Intronic
1128476731 15:68003772-68003794 CTCAAGCATGATCATGATTGCGG - Intergenic
1128845971 15:70894983-70895005 CTCTAGAAACATTATAATGGTGG - Intronic
1131932448 15:97459063-97459085 CTCAAGACTCAACAACATGTTGG + Intergenic
1133337695 16:5016684-5016706 CACAAGAATCATCTTTATGCAGG + Exonic
1137575560 16:49597696-49597718 CTCTAGAATCATAATGTTGGGGG - Intronic
1139066609 16:63323413-63323435 CTCAAGGTTCATCACAATGGTGG - Intergenic
1143632028 17:8144976-8144998 CTCAGACATCATCATGATGGAGG - Exonic
1147485557 17:40809328-40809350 TACAATAATCATCATAATGGTGG + Intergenic
1148693032 17:49543980-49544002 CTCAGGAAACATAACCATGGTGG + Intergenic
1149092694 17:52803572-52803594 TACAAGCATCAGCATCATGGAGG - Intergenic
1149641879 17:58208105-58208127 CAGAAGATTCATCCTCATGGAGG + Exonic
1150523049 17:65889648-65889670 TTAAAGAATCATGAGCATGGAGG - Intronic
1152776960 17:82207983-82208005 CACAAGAATCATCAGCACAGAGG - Intronic
1153555669 18:6310692-6310714 CCCAAAAATAATCACCATGGAGG + Intronic
1154370354 18:13755813-13755835 ATCACGAGTCATCATGATGGCGG + Intronic
1155816733 18:30320828-30320850 TTCAGGAAGCTTCATCATGGTGG + Intergenic
1156615961 18:38784414-38784436 CTCAAAAAACTTAATCATGGTGG + Intergenic
1157165659 18:45356357-45356379 TTCAATAATCATCATCATATAGG + Intronic
1159133304 18:64306293-64306315 CTGGAAAATCATGATCATGGTGG + Intergenic
1162762276 19:12895915-12895937 CTCAAAAATTATCCTCGTGGCGG - Intronic
1164751572 19:30659227-30659249 CTCAAGAAACTTAGTCATGGTGG + Intronic
1164898497 19:31898103-31898125 CTCAGGAAACATAATCATGGTGG + Intergenic
1168626741 19:57924463-57924485 CACAAGATTCATAATTATGGAGG + Intronic
925482272 2:4288921-4288943 CTCAGGAAGCAGGATCATGGCGG + Intergenic
926011394 2:9411170-9411192 ATAAAAAATCATCATCATGAAGG - Intronic
927098777 2:19770638-19770660 CTCAGGAAACACAATCATGGTGG + Intergenic
928899390 2:36301180-36301202 CTCAGGAAACACAATCATGGTGG + Intergenic
931162710 2:59711314-59711336 TTCTGGAATCATCATCATGTAGG - Intergenic
932747442 2:74345472-74345494 CTCAGGAATCCTCCTAATGGAGG + Intronic
934111315 2:88746481-88746503 CTCAAGAATCCTCATCCTTAGGG - Intronic
937861675 2:126716254-126716276 CTCTAGAATAGTCATCATTGTGG + Intergenic
938742070 2:134242150-134242172 CTCAAAGTTCAACATCATGGGGG - Intronic
938815039 2:134893598-134893620 CATAGGAATCATCAACATGGTGG - Intronic
939147132 2:138429224-138429246 CTCAGGAAACATGATCATAGTGG - Intergenic
942574098 2:177344527-177344549 CTGAAGAAACTTCATCATTGAGG + Intronic
943558990 2:189438949-189438971 CTGGAGAATAATCATCAAGGGGG - Intergenic
944489250 2:200241120-200241142 CTCTAGAATCATCTTCTGGGAGG + Intergenic
945774404 2:214086601-214086623 CTCAGGAAACATAATCACGGTGG - Intronic
946225092 2:218260308-218260330 CTCATGCCTCTTCATCATGGGGG + Intronic
948012267 2:234658674-234658696 CTCAGGAAACATAATCACGGCGG + Intergenic
948485797 2:238279983-238280005 CTCACGAAGCATCTTCCTGGTGG - Intronic
1172114921 20:32568104-32568126 CACTATAATCATCATCATGACGG + Intronic
1173784517 20:45783004-45783026 CTCATGACTCATCATCATCTTGG + Intronic
1174541461 20:51292987-51293009 CTCAGGAAACACAATCATGGCGG + Intergenic
1177285468 21:19042867-19042889 CTCAGGAAACATCATCTTGGAGG + Intergenic
1177555636 21:22684196-22684218 CACAAAAAGCATCATCATGGGGG - Intergenic
1177679758 21:24351529-24351551 CTCAGGAAACATAATCATGGTGG + Intergenic
1178414820 21:32395224-32395246 CTGAAAAATCATCTTCATGTTGG - Intergenic
1181129477 22:20722090-20722112 CTCAGGAAACAGAATCATGGTGG - Intronic
1182111022 22:27723785-27723807 CTCAGGACTCATCTTCATGGAGG + Intergenic
1183915240 22:41112590-41112612 CTCAAAAATCATCATCAAGTTGG - Intronic
1185226677 22:49657442-49657464 CTCAGGAAACACAATCATGGCGG + Intronic
951034849 3:17921632-17921654 CTCAGGAAACACAATCATGGTGG - Intronic
951966977 3:28398333-28398355 CTCAAATATAATCATCTTGGGGG + Intronic
955644726 3:61124928-61124950 CTGATGAAACATCAGCATGGAGG - Intronic
956164344 3:66385034-66385056 CTTGAGAATCATCAGAATGGTGG - Intronic
957784636 3:84866335-84866357 CTCAGGAAACACAATCATGGTGG - Intergenic
965224488 3:165971309-165971331 CTCAAGAAACACAATCATTGTGG - Intergenic
966217533 3:177518878-177518900 CTCAGGAAACATAATCATGGTGG + Intergenic
966414635 3:179676170-179676192 CTCAGGAAACAAAATCATGGCGG - Intronic
967566406 3:190978786-190978808 CTCAGGAAACATAATCACGGTGG - Intergenic
969103496 4:4787691-4787713 CTCAGGAAACACAATCATGGCGG - Intergenic
969862671 4:10049903-10049925 CCCAAGGATCATCACCATTGGGG + Intronic
970833970 4:20377937-20377959 ATCAATAATCACCATAATGGTGG + Intronic
972517300 4:39820323-39820345 CTCAGGAAACTTAATCATGGTGG + Intergenic
972642128 4:40934482-40934504 TACAAGAATCATCATCATCAGGG + Exonic
974949164 4:68567427-68567449 TTCAAGAAACATCTTCATGAAGG - Intronic
974958198 4:68669557-68669579 CTCAAGAAACATCTTCATGAAGG - Intronic
975416188 4:74107045-74107067 CTAAAGAATAATGATCATGGTGG + Intergenic
975626886 4:76359159-76359181 CTCAGAAAACATAATCATGGTGG - Intronic
977138726 4:93339789-93339811 CTCAGGAAACACAATCATGGTGG + Intronic
977736412 4:100421869-100421891 TTCAAGAATCATCTTCACTGTGG - Intronic
978372146 4:108039697-108039719 CTCTTGATTCATCATCAAGGAGG + Intergenic
979454729 4:120914572-120914594 CTCAGGAAACAGAATCATGGTGG + Intronic
981537751 4:145817475-145817497 CTCAAGAAGCAGAATCATGGCGG + Intronic
983353392 4:166623222-166623244 CTCAAGCATCATCATCACTAAGG + Intergenic
984306939 4:178005491-178005513 CTCAGGAAACATAATCATGGTGG + Intergenic
986082135 5:4405950-4405972 CTCAAAAATCATCTGCATGTTGG - Intergenic
987003928 5:13689568-13689590 CTCAGGAAACGTAATCATGGTGG - Intergenic
987387358 5:17342690-17342712 CTTAAGAAGTATCATCATGCCGG + Intergenic
987668649 5:20979889-20979911 GTCAATAGTCATCAACATGGTGG - Intergenic
988119455 5:26942114-26942136 CTCAGGAAACACAATCATGGTGG + Intronic
989197162 5:38726884-38726906 CTCAGGAAACACAATCATGGCGG + Intergenic
989817356 5:45752057-45752079 CTCAGGAAACATCATCATGGTGG + Intergenic
990182764 5:53180771-53180793 CTCAGGAAACATAATCATGACGG - Intergenic
991111509 5:62905270-62905292 CTTAGGAAACATAATCATGGTGG + Intergenic
993713662 5:91253019-91253041 CTCAGGAAACACAATCATGGTGG - Intergenic
999787535 5:154905468-154905490 CTCTAGAAACTACATCATGGGGG + Exonic
1006973976 6:38079376-38079398 CTCAACATGCATCATCATGAAGG - Intronic
1007335289 6:41151083-41151105 CTGAAGAATCACCAGCATGAAGG + Intronic
1008848055 6:55992618-55992640 CTCAGGAGACATAATCATGGTGG + Intergenic
1009773300 6:68173356-68173378 CTCAGGAAACAGAATCATGGTGG - Intergenic
1011518914 6:88182712-88182734 CTCAGAAAACATAATCATGGTGG - Intergenic
1011981560 6:93385853-93385875 CTCAGGAAACATAATCATGGTGG + Intronic
1014141012 6:117942009-117942031 CTTAAGCATCATTGTCATGGAGG + Intronic
1014951357 6:127559231-127559253 CTCAGGAAACACAATCATGGAGG - Intronic
1016619525 6:146091901-146091923 CTCAAGAAACACAAACATGGTGG + Intronic
1018064850 6:160117699-160117721 CTTAAGGAGCATGATCATGGAGG + Intergenic
1028393220 7:90338414-90338436 CTCAGGAAACTTAATCATGGTGG - Intronic
1028528837 7:91815869-91815891 CTCAAGAATCAACAATATGGAGG + Intronic
1031340406 7:120593601-120593623 ATCATTAATCATCATCATGGTGG - Intronic
1032366630 7:131306140-131306162 CTCAGGAAACGTAATCATGGTGG - Intronic
1033425343 7:141239006-141239028 CACAATAATCATCACAATGGAGG + Intronic
1034477640 7:151296021-151296043 CTCAGGAAACACAATCATGGTGG + Intergenic
1037151696 8:15643176-15643198 CTCAGTAAACATGATCATGGCGG - Intronic
1038334654 8:26636437-26636459 CTCACGTATCATCATCATCTAGG - Intronic
1040711677 8:50195941-50195963 CTCAAGAATCATCATCATGGAGG - Intronic
1040945793 8:52883014-52883036 TTCAGGAAACATAATCATGGTGG + Intergenic
1041265607 8:56061239-56061261 CTCAGGAAACTTAATCATGGCGG - Intergenic
1043102330 8:76061240-76061262 CTCAGGAAACATAATCATGGTGG - Intergenic
1047151369 8:122267269-122267291 CTCAGGAAACATAATCATGGCGG + Intergenic
1049917520 9:332952-332974 CTAAAAAATCATCATCAGGCTGG - Intronic
1050843660 9:10186916-10186938 CTCAAGAACATTAATCATGGGGG - Intronic
1052705648 9:31990450-31990472 CTCTAGAAGCTTCATCATAGAGG - Intergenic
1056398176 9:86200772-86200794 CTGAAGAATCACCCTCATGAAGG - Intergenic
1057075280 9:92135272-92135294 CTCAGGAAGCATCCTGATGGGGG + Intergenic
1058653310 9:107197181-107197203 CTCAGGAAACACAATCATGGCGG + Intergenic
1059617959 9:115971464-115971486 CTCAGAAAACATAATCATGGTGG + Intergenic
1060257936 9:122048774-122048796 CTGAGAGATCATCATCATGGAGG - Intronic
1060369256 9:123054183-123054205 CTCAAAGATCATCATAATTGGGG + Intronic
1062154790 9:135040981-135041003 CTCAAGAATCTCCAGGATGGCGG + Intergenic
1186447752 X:9646170-9646192 TTCTAAAATCATCTTCATGGCGG + Intronic
1188473235 X:30563289-30563311 CTCAGGAAACACAATCATGGTGG - Intronic
1189728871 X:43997769-43997791 TTCAGGAAACATAATCATGGTGG + Intergenic
1191925121 X:66300720-66300742 CTCAAAAATCACCTTCATGTAGG + Intergenic
1195921736 X:109990500-109990522 CTCAAGAATTCTCAGAATGGTGG + Intergenic
1196011554 X:110893328-110893350 CTCAAGGATCATCATCTTTTAGG - Intergenic
1197581767 X:128293227-128293249 CTGAGGAAACATAATCATGGTGG - Intergenic
1197740470 X:129888623-129888645 CTCAGGAAACAGAATCATGGTGG - Intergenic
1199110973 X:143934422-143934444 CTCAAGGTTCATCCTCATTGTGG + Intergenic
1201503898 Y:14676620-14676642 CTCAAGAATCATCCACATAGAGG - Intronic
1201608571 Y:15815297-15815319 CTCAGGAATGATAAACATGGTGG + Intergenic
1202245240 Y:22813295-22813317 CTCAGGAATCAGGATCAAGGCGG + Intergenic
1202398230 Y:24447041-24447063 CTCAGGAATCAGGATCAAGGCGG + Intergenic
1202472551 Y:25223045-25223067 CTCAGGAATCAGGATCAAGGCGG - Intergenic