ID: 1040717563

View in Genome Browser
Species Human (GRCh38)
Location 8:50275857-50275879
Sequence TTAGATCCAAGTAAGAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040717563_1040717565 7 Left 1040717563 8:50275857-50275879 CCACCATTCTTACTTGGATCTAA 0: 1
1: 0
2: 1
3: 13
4: 182
Right 1040717565 8:50275887-50275909 TAACTTGTTTCTCTTTGCTCTGG No data
1040717563_1040717566 19 Left 1040717563 8:50275857-50275879 CCACCATTCTTACTTGGATCTAA 0: 1
1: 0
2: 1
3: 13
4: 182
Right 1040717566 8:50275899-50275921 CTTTGCTCTGGTTTCTCTTGAGG No data
1040717563_1040717568 26 Left 1040717563 8:50275857-50275879 CCACCATTCTTACTTGGATCTAA 0: 1
1: 0
2: 1
3: 13
4: 182
Right 1040717568 8:50275906-50275928 CTGGTTTCTCTTGAGGAGGATGG No data
1040717563_1040717567 22 Left 1040717563 8:50275857-50275879 CCACCATTCTTACTTGGATCTAA 0: 1
1: 0
2: 1
3: 13
4: 182
Right 1040717567 8:50275902-50275924 TGCTCTGGTTTCTCTTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040717563 Original CRISPR TTAGATCCAAGTAAGAATGG TGG (reversed) Intronic
901278798 1:8014973-8014995 TTCGATACTAGTAAGAAAGGTGG + Intronic
901623100 1:10604996-10605018 TTCCCTCCAAGTCAGAATGGAGG - Intronic
906681320 1:47727569-47727591 TTAGGTACAAGACAGAATGGGGG + Intergenic
908603820 1:65771425-65771447 GTAGATTGAAGAAAGAATGGAGG - Intergenic
910357479 1:86377069-86377091 TTACTTCCAAGAAACAATGGGGG + Intronic
911547978 1:99243756-99243778 TAAGCTCAAAGTAAGAATGCAGG + Intergenic
913185413 1:116366242-116366264 TAAGGTCCAAGGAAGAATGAAGG - Intergenic
913553690 1:119941736-119941758 TTAGATCCTTGCCAGAATGGAGG - Exonic
920372384 1:205487361-205487383 TTAGATCCAAGTTAGAGCGGTGG - Intergenic
921026373 1:211286868-211286890 TTAGATTCAGGAAAGAAGGGTGG - Intronic
921709007 1:218354723-218354745 ATACATCCATGGAAGAATGGTGG + Intronic
922039525 1:221883040-221883062 TTAGAGCCATGTAAGAATCTTGG + Intergenic
1064841136 10:19593537-19593559 ATAGAGCCAAGTAGCAATGGAGG - Intronic
1065304887 10:24358585-24358607 TTATATCAAAGTAGGAAGGGTGG + Intronic
1066172668 10:32868420-32868442 TTAGATCCATATGAGAATTGAGG - Intronic
1068609748 10:59045990-59046012 TTAGATCCAGGTAAAATTTGGGG + Intergenic
1070356596 10:75646057-75646079 GAAGACCCAAGAAAGAATGGGGG - Intronic
1072310103 10:94146351-94146373 TTAGAGTCAGTTAAGAATGGAGG + Intronic
1072310438 10:94149101-94149123 TTAGAGTCAGTTAAGAATGGAGG + Intronic
1074177351 10:111022484-111022506 TTAGATCCATCAGAGAATGGAGG + Intergenic
1078819872 11:14867749-14867771 CTAAATCCAAGTAAGAATATAGG + Exonic
1079070831 11:17345286-17345308 TTAGAACCATTTAAGAATGATGG + Intronic
1079998264 11:27319498-27319520 TTAGATGCAGGTGAGAATGTGGG + Intergenic
1081455572 11:43219155-43219177 TTACATTCAAGTTGGAATGGAGG - Intergenic
1081458907 11:43252895-43252917 TTATATCAGAGGAAGAATGGTGG - Intergenic
1081624470 11:44640946-44640968 TGAGATGCAAGAAAGAATGGTGG + Intergenic
1086193990 11:84115222-84115244 TTTGAGCCCAGTGAGAATGGTGG - Intronic
1086374352 11:86185077-86185099 TTCCATCCAAGTCAGAATGTAGG + Intergenic
1086589749 11:88499542-88499564 TTAGACCCAAGTAACCATGATGG - Intergenic
1087335923 11:96844674-96844696 TTATATCTTAGTAAGAATGAGGG + Intergenic
1087480487 11:98693789-98693811 TTACTTCCAAGAAAAAATGGGGG - Intergenic
1091307421 11:134545508-134545530 TTAGATCCATTAAAGAATGGAGG + Intergenic
1091515657 12:1178522-1178544 ATAGATACATGGAAGAATGGAGG + Intronic
1092312992 12:7378520-7378542 TTAGATCCAAGTGAAGAAGGGGG - Intronic
1092500832 12:9045175-9045197 TTAGATCCATCAAAGAATTGAGG + Intergenic
1096634645 12:52950401-52950423 TTAGAGTCAAGTAAGTTTGGGGG + Exonic
1097741840 12:63252489-63252511 TTAAATCCAAGCAGGAAAGGAGG - Intergenic
1098820567 12:75222374-75222396 ATAGATCCAATAAAGCATGGTGG + Intergenic
1099328368 12:81249035-81249057 GCAGATCCAAGTAAAAATGAGGG + Intronic
1099367387 12:81784848-81784870 CTATATCCTAGCAAGAATGGAGG - Intergenic
1108155142 13:47576912-47576934 TTACATCCAAGATACAATGGAGG + Intergenic
1108890676 13:55254381-55254403 TTATTTCCAAGTGAGAATAGGGG - Intergenic
1111265327 13:85803965-85803987 TTAGATCAAATTAAGTATGGAGG - Intergenic
1113251053 13:108452881-108452903 TTAGATGAAAGTAAGAAAGGAGG + Intergenic
1114408839 14:22481744-22481766 ATAAATCCAAGTAAGTGTGGAGG + Intergenic
1115975845 14:38995974-38995996 GTGGATCCCAGAAAGAATGGAGG + Intergenic
1116018602 14:39434633-39434655 TCAAATCCAAATAAGCATGGTGG - Intergenic
1117933422 14:60872537-60872559 CTAGATCTGAGTAATAATGGGGG - Intronic
1118278700 14:64409517-64409539 TTAGATCAAAGTAGGAAAGGAGG - Intronic
1119667413 14:76494937-76494959 TGAGGACCAAGTAAGAGTGGAGG - Intronic
1120389587 14:83888766-83888788 TTACTTCCAAGAAACAATGGGGG - Intergenic
1122563427 14:102633515-102633537 TTAGTTGCAATTAAAAATGGAGG + Intronic
1125444114 15:39735122-39735144 TTAGATACCAGTAAGAATTAAGG - Intronic
1128330126 15:66750302-66750324 TTAGCTCCGAGTTAGACTGGGGG + Intronic
1130019055 15:80211723-80211745 TTAGATAAAAGTAAGAAAAGAGG + Intergenic
1131855624 15:96590581-96590603 TGAGATACAATTAAAAATGGGGG - Intergenic
1132261118 15:100425577-100425599 TTAGTTCCAAGACACAATGGGGG - Intronic
1138164307 16:54785981-54786003 TAACATCCAAGTAAGCATGGAGG + Intergenic
1138500650 16:57441223-57441245 TTAGAGGCAAGTAAGAAGGTTGG + Intronic
1140205783 16:72932142-72932164 TTAGATGCAAGTTAGAACGTAGG - Intronic
1141115004 16:81300915-81300937 TTACATCCTAGTGAGAAAGGTGG - Intergenic
1148814255 17:50315247-50315269 TTTGTTACAAGTAAGAATAGGGG - Intergenic
1149081908 17:52667825-52667847 TTACATCCAAGATACAATGGTGG + Intergenic
1153273104 18:3342522-3342544 TTAGATCCAAGTAAAAGAGCAGG - Intergenic
1153951246 18:10059636-10059658 TTAAAACCAAGGAAGAATGAAGG + Intergenic
1156602199 18:38621448-38621470 TTAAATACAAGTAAGTAGGGTGG - Intergenic
1158795289 18:60838565-60838587 CTAGATTCAAGGAGGAATGGAGG - Intergenic
1160175305 18:76588900-76588922 TTAGATCCAGGAAAGGAAGGTGG - Intergenic
1160396337 18:78574976-78574998 TTACTTCCAAGAAACAATGGAGG - Intergenic
1164784042 19:30915303-30915325 TTAGAACAAAATGAGAATGGGGG - Intergenic
925224218 2:2168806-2168828 TTACTTCCAAGAAATAATGGAGG + Intronic
925957515 2:8981969-8981991 TTAGATCCAAATATGAGTAGTGG + Intronic
926130635 2:10301784-10301806 TCAGAGCCAAGTAAGAATGAGGG + Intergenic
926878029 2:17507049-17507071 ATACATCCAAGTAAGAATTTTGG + Intergenic
931987877 2:67758665-67758687 TGAATTCCAAGTAAGAAAGGAGG - Intergenic
933399594 2:81777140-81777162 TTAGATCCATAAAAGAATTGAGG - Intergenic
934075799 2:88427853-88427875 TAGGAAACAAGTAAGAATGGTGG - Intergenic
935455772 2:103266083-103266105 ATAAAGCCAAGGAAGAATGGTGG + Intergenic
935510945 2:103972779-103972801 TTAAATCCAAGCAAGAATTCAGG - Intergenic
936905815 2:117534486-117534508 TTACTTCCAAGAAACAATGGGGG - Intergenic
937205562 2:120234542-120234564 TTTAATCCAAGAAAGAAAGGGGG - Intergenic
938710875 2:133975412-133975434 TGAGGTCCCAGTAAGAATGCAGG + Intergenic
939361332 2:141176067-141176089 TTATATCCAAGATACAATGGAGG - Intronic
941943115 2:171064945-171064967 TAAGTTCCAAGTAAAATTGGAGG - Intronic
942694836 2:178629849-178629871 TTAGATTCAAGAAAGAAGGTGGG - Intronic
945406612 2:209456477-209456499 TTAGATATGAGAAAGAATGGTGG + Intronic
945608085 2:211961965-211961987 TTCTATACAAGTAAGAATGGTGG + Intronic
946754367 2:222929153-222929175 GTAGATGCAAGTAAGAATTATGG + Intronic
947309527 2:228785479-228785501 TCACGTCCAAGTAAGAATGAAGG - Intergenic
947391065 2:229639941-229639963 TAAGATCCAAGTTCAAATGGAGG - Intronic
947889550 2:233605085-233605107 TTACTTCCAAGTTACAATGGAGG + Intergenic
948837781 2:240634536-240634558 TTATATCCTAGATAGAATGGGGG - Intergenic
1170006206 20:11672088-11672110 CTAGATACAAAGAAGAATGGTGG - Intergenic
1171938554 20:31301155-31301177 TAAGATCCTAGGAAGAATGGAGG - Intergenic
1175432094 20:58912504-58912526 TAAAATCCAAGTAAAAATCGGGG + Intergenic
1177918303 21:27118999-27119021 TCAGAACCAAGTAATAATGTAGG - Intergenic
1178147882 21:29760458-29760480 TTAAATACAAGTAAGCTTGGCGG + Intronic
1178933795 21:36843149-36843171 TAAGATACTAGAAAGAATGGTGG + Intronic
1179676754 21:42988352-42988374 TTTGGTCCAAGTAAGAACTGAGG - Intronic
951186171 3:19715982-19716004 TGAGATCCAAGTAAAATTTGGGG - Intergenic
951738508 3:25894700-25894722 CTAGATTCTAGTGAGAATGGGGG - Intergenic
952239814 3:31519529-31519551 TTTGATCCAGGTGAGAATGCAGG - Intergenic
953478268 3:43225037-43225059 ATAGAACCAAAGAAGAATGGTGG - Intergenic
958780374 3:98533475-98533497 TTAGAGCCCAGTATGAAGGGTGG - Intronic
958904009 3:99922215-99922237 TTAGTGCCAAATAAGTATGGAGG + Intronic
959874594 3:111367698-111367720 TTAGACCCAAGTTTGAATGCTGG + Intronic
959923251 3:111893302-111893324 GGAGATTCAAGTAAGACTGGAGG - Intronic
960208293 3:114929938-114929960 TTATATTCAAGTAAGAATAAGGG - Intronic
960474395 3:118106672-118106694 TTTGACCTAAGTAAGATTGGAGG - Intergenic
960551966 3:118985931-118985953 TTATATCCTATAAAGAATGGGGG - Intronic
962162520 3:133013942-133013964 TTACATCCAAGATACAATGGGGG - Intergenic
962816740 3:139006889-139006911 TTAGAACCACGTAGGAAGGGTGG - Intronic
962853321 3:139323988-139324010 TTAGCACCAAGTCAGAAAGGTGG - Intronic
963311008 3:143709848-143709870 TCAGATCAAAGGAATAATGGAGG - Intronic
963833119 3:150029982-150030004 GTAGATTTAAGTGAGAATGGTGG + Intronic
965391730 3:168112509-168112531 TTAGATCCTTGCATGAATGGTGG + Intergenic
966146282 3:176815504-176815526 TTAGATCCAATTAGTAATTGTGG - Intergenic
971776085 4:30967134-30967156 TTAAATCCATATAAGAATTGTGG + Intronic
972014852 4:34231278-34231300 TTAGTTCCAAGTTACAATGGGGG - Intergenic
972148374 4:36058317-36058339 TAAAATCCTAGCAAGAATGGAGG - Intronic
973537370 4:51896851-51896873 TTACATCCTAGGAACAATGGAGG - Intronic
973838324 4:54834365-54834387 TTAGATCCAACAAAGAAGTGAGG + Intergenic
976570008 4:86596312-86596334 TTACATGCAAGTAAAAATGGTGG - Intronic
977855941 4:101893049-101893071 TTAGATTCAACTAACTATGGTGG + Intronic
978721386 4:111914274-111914296 TTAGAGACAGGTAAGACTGGAGG - Intergenic
979507754 4:121517203-121517225 TTAGAACTAAGCAAGAAGGGAGG - Intergenic
980481102 4:133388657-133388679 TTAGATTCAGGTAAAAATGTCGG + Intergenic
980924198 4:139117981-139118003 TTAGATATAAGCAAGAATGATGG + Intronic
984571838 4:181404235-181404257 TTACTTCCAAGAAACAATGGGGG + Intergenic
989520126 5:42391823-42391845 TTACATCCAAGATACAATGGGGG + Intergenic
989982378 5:50659778-50659800 CTAGGTCCAAGTAAGTTTGGAGG - Intergenic
993478611 5:88395703-88395725 TTAGATATAAGTAAGAATGGTGG - Intergenic
993505783 5:88707179-88707201 ATAGATCCAGGTGACAATGGTGG + Intergenic
994982762 5:106898258-106898280 TTAGAAAGGAGTAAGAATGGAGG - Intergenic
995782138 5:115788902-115788924 TTACATCCAAGATACAATGGTGG - Intergenic
996201749 5:120684454-120684476 TTAGACCTAAGTAAGAGAGGAGG + Intronic
997047032 5:130330819-130330841 TTAGTTCCAAGATACAATGGTGG - Intergenic
997091487 5:130864054-130864076 TTACTTCCAAGAAACAATGGAGG + Intergenic
997247126 5:132359233-132359255 TAAGATACAAGAAAGAAGGGGGG + Intergenic
998023160 5:138788857-138788879 TGAGATCCAAGTATAAATTGTGG - Intronic
1000707684 5:164531665-164531687 TCAGATACAAGTAAGAACAGAGG + Intergenic
1005358655 6:25009496-25009518 TTTGATCAAAGTTAAAATGGAGG - Intronic
1005457843 6:26038553-26038575 TTAGATCACAGAAAGAATTGGGG - Intergenic
1007679231 6:43622924-43622946 TTACATCCAAGTCAGAATTTAGG - Intronic
1008702223 6:54114996-54115018 TCAGCTCCAAGTGAGAATGTGGG + Intronic
1011839412 6:91478023-91478045 TTAGATTAAAGAAAGAATGAAGG - Intergenic
1012078589 6:94727164-94727186 TTACTTCCAAGTTATAATGGGGG + Intergenic
1012090462 6:94888080-94888102 TTAGATCCATATAATAAGGGAGG - Intergenic
1013622399 6:111902676-111902698 TTAGTTCCAAGAAAGAAGAGGGG + Intergenic
1013835229 6:114326870-114326892 TTAAATCCTATTAAGAATAGAGG - Intronic
1015472788 6:133624879-133624901 TTTGATGGAAATAAGAATGGTGG - Intergenic
1016261378 6:142174431-142174453 TTATTTCTAAGAAAGAATGGTGG - Intronic
1016613827 6:146024597-146024619 TTACATCCAAGACAAAATGGAGG - Intergenic
1017755809 6:157528148-157528170 TTAGATCTAGGGAAAAATGGTGG - Intronic
1017774731 6:157672026-157672048 TTAGAGAGAAGGAAGAATGGTGG - Intronic
1018546023 6:164936937-164936959 TTAGATCCATGAGAGAATGGAGG + Intergenic
1020662768 7:11002250-11002272 TTAGAAGAAAGTAAAAATGGGGG + Intronic
1022048480 7:26643035-26643057 TCAGCTCCAAGAAAGAAAGGTGG - Intronic
1022321445 7:29291786-29291808 ATAGATTCATGTAAGAATCGTGG - Intronic
1026992400 7:74594569-74594591 TAAGACCCAAATAAAAATGGGGG - Intronic
1028227827 7:88269660-88269682 GTAGATCCAAAAAAAAATGGGGG - Intergenic
1028652978 7:93171111-93171133 TAAAATCCAAGCAAGCATGGAGG - Intergenic
1034154308 7:148942362-148942384 TTATAACCAGCTAAGAATGGAGG + Intergenic
1034195193 7:149240767-149240789 TTAGATCTTTGTGAGAATGGAGG + Intronic
1034687105 7:152981965-152981987 TGAGATCCAGCTAAGAGTGGTGG - Intergenic
1036471418 8:9056035-9056057 TAGGATCCAAGTAACAATGTTGG - Intronic
1036753653 8:11458310-11458332 TCAGATCCAAGTGTGAAGGGAGG - Intronic
1037040159 8:14221633-14221655 TTAGATTCAAATAAGAAGTGGGG + Intronic
1040008533 8:42641505-42641527 GTAGATACAAATAAGAATGAGGG - Intergenic
1040717563 8:50275857-50275879 TTAGATCCAAGTAAGAATGGTGG - Intronic
1041245117 8:55881495-55881517 TTACCTCCAAATGAGAATGGAGG - Intronic
1041392616 8:57360233-57360255 TTACTTCCAAGTTACAATGGGGG - Intergenic
1041494504 8:58470308-58470330 TTAGTTCCTAGTTACAATGGGGG - Intergenic
1041828773 8:62128672-62128694 TAAGACCCAAATAAGATTGGTGG + Intergenic
1043213880 8:77560618-77560640 TTAGATCCATGAAAGAAGTGAGG + Intergenic
1044126979 8:88471340-88471362 TTACTTCCAAGAAACAATGGGGG + Intergenic
1044815532 8:96108565-96108587 TCAGATGCACGTGAGAATGGCGG - Intergenic
1045784219 8:105902271-105902293 TTAGTTCCAAGGTACAATGGGGG + Intergenic
1046088525 8:109469155-109469177 TTTGATCCCAGTAAGAATAACGG - Intronic
1046570583 8:115960530-115960552 TGAGTTCCCAGAAAGAATGGCGG - Intergenic
1047140968 8:122139240-122139262 TTAGCTGCAGGTAAAAATGGTGG + Intergenic
1049031447 8:140041022-140041044 TAATATCCAGGTATGAATGGTGG + Intronic
1051777150 9:20647415-20647437 TTAGCTACAAGGAAAAATGGGGG + Intergenic
1052112117 9:24599207-24599229 TTGGATACAAGTAGGCATGGGGG - Intergenic
1052314066 9:27097874-27097896 TTACTTCCAAGAAACAATGGTGG - Intergenic
1056471995 9:86914551-86914573 TAAGATCCAATTTAGATTGGTGG - Intergenic
1058776773 9:108292221-108292243 TTAGAACAAAGTAACAAGGGTGG + Intergenic
1062312471 9:135946409-135946431 ATAGATCCAAGTAGGTTTGGTGG - Intronic
1194093409 X:89604603-89604625 TTACTTCCAAGAAACAATGGTGG - Intergenic
1195210303 X:102647881-102647903 TTAAATCCATGTTAGAAAGGAGG + Intergenic
1196246376 X:113404502-113404524 TTATATCCAAGATACAATGGAGG - Intergenic
1197569590 X:128132272-128132294 TTACTTCCAAGAAAGAATAGGGG - Intergenic
1197897769 X:131333807-131333829 TTCAATCTAAGAAAGAATGGTGG + Intronic
1198951985 X:142082084-142082106 TTACATCCAAGAAACAAAGGGGG + Intergenic
1199091886 X:143702352-143702374 TTACTTCCAAGATAGAATGGAGG - Intergenic
1199393364 X:147307159-147307181 TTACTTCCAAGTTACAATGGGGG + Intergenic
1200446039 Y:3260712-3260734 TTACTTCCAAGAAACAATGGTGG - Intergenic