ID: 1040717564

View in Genome Browser
Species Human (GRCh38)
Location 8:50275860-50275882
Sequence TTCTTAGATCCAAGTAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040717564_1040717566 16 Left 1040717564 8:50275860-50275882 CCATTCTTACTTGGATCTAAGAA 0: 1
1: 0
2: 2
3: 25
4: 183
Right 1040717566 8:50275899-50275921 CTTTGCTCTGGTTTCTCTTGAGG No data
1040717564_1040717567 19 Left 1040717564 8:50275860-50275882 CCATTCTTACTTGGATCTAAGAA 0: 1
1: 0
2: 2
3: 25
4: 183
Right 1040717567 8:50275902-50275924 TGCTCTGGTTTCTCTTGAGGAGG No data
1040717564_1040717568 23 Left 1040717564 8:50275860-50275882 CCATTCTTACTTGGATCTAAGAA 0: 1
1: 0
2: 2
3: 25
4: 183
Right 1040717568 8:50275906-50275928 CTGGTTTCTCTTGAGGAGGATGG No data
1040717564_1040717565 4 Left 1040717564 8:50275860-50275882 CCATTCTTACTTGGATCTAAGAA 0: 1
1: 0
2: 2
3: 25
4: 183
Right 1040717565 8:50275887-50275909 TAACTTGTTTCTCTTTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040717564 Original CRISPR TTCTTAGATCCAAGTAAGAA TGG (reversed) Intronic
902645546 1:17795510-17795532 CTCTTAGACCCAAGTAACAGAGG - Intronic
903131703 1:21283817-21283839 TTCATAGTTCCAGGCAAGAATGG + Intronic
904915266 1:33965653-33965675 TTATTAAATACAGGTAAGAATGG + Intronic
907396105 1:54191042-54191064 TTCTTAGATCCAATTTTGAAAGG - Intronic
909031645 1:70548457-70548479 TTCTTAGATCCATCAGAGAATGG + Intergenic
911060471 1:93743605-93743627 TGCTTAGATCCAAATTAGACAGG - Intronic
911139885 1:94488325-94488347 ATCTAAGATCCAAGAAAAAAAGG - Intronic
911176398 1:94821867-94821889 TTGTTCTTTCCAAGTAAGAAAGG + Intronic
913296038 1:117321292-117321314 TTCTTAGATTCGATGAAGAATGG - Intergenic
913695644 1:121322723-121322745 TTCTGAAGTCCAAGTAAGTATGG + Intronic
914141921 1:144957336-144957358 TTCTGAAGTCCAAGTAAGTATGG - Intronic
915894732 1:159802948-159802970 TTCTTAGAACCAGGTAACAATGG + Intronic
917934530 1:179851978-179852000 TTCTTTAATAAAAGTAAGAATGG + Intronic
918271702 1:182907512-182907534 TTCTTTGATCCCAATGAGAATGG + Intronic
919403691 1:197149819-197149841 TTCCTAGATCCAAGGAACAAGGG + Intergenic
919973478 1:202595568-202595590 TCCTGAGGTCCAGGTAAGAAGGG - Exonic
920482972 1:206341105-206341127 TTCTGAAGTCCAAGTAAGTATGG + Intronic
920795630 1:209133639-209133661 TTCTTAGATCCATCAGAGAATGG + Intergenic
921822957 1:219638657-219638679 TTCTTGGACCCAACTAAGAATGG - Intergenic
923367849 1:233280620-233280642 TTCCTAGAGCCATGTAAAAATGG + Intronic
923650869 1:235872387-235872409 TGCTTAGATTCAATGAAGAATGG + Intronic
924824679 1:247526875-247526897 AACTTAAATCCAAGTAAGATGGG + Intronic
1063058254 10:2525509-2525531 ATCTGAGCTCCAAGTAAGAGCGG + Intergenic
1064904091 10:20326601-20326623 TTCTTTGCTCAAATTAAGAAAGG + Intergenic
1065022633 10:21513109-21513131 TTCTTAGATTCAAGATAGCAAGG + Intergenic
1065304886 10:24358582-24358604 GTCTTATATCAAAGTAGGAAGGG + Intronic
1066078698 10:31907789-31907811 TTCTTGGAACCAAGTCAAAATGG + Intronic
1066505275 10:36036031-36036053 TTCTCACATCCATGAAAGAAGGG - Intergenic
1069286039 10:66716680-66716702 TGCTTAGATCCAGGAAAGAAAGG - Intronic
1073960651 10:108923680-108923702 TTCACAGATACAAGCAAGAAAGG - Intergenic
1074098343 10:110332951-110332973 TTCTTAGAAACAAGTAATTAGGG - Intergenic
1074177350 10:111022481-111022503 TTCTTAGATCCATCAGAGAATGG + Intergenic
1075966719 10:126618180-126618202 TTCTTAGGTCCAAAAAATAATGG - Intronic
1079484757 11:20923638-20923660 TTCTGAGATTGAAGTCAGAATGG - Intronic
1080032173 11:27673317-27673339 TTCTCAGATCCAAGGATAAAGGG + Intronic
1080274037 11:30483600-30483622 TTCAAAGATCAAAGCAAGAAAGG + Intronic
1080459792 11:32444314-32444336 TCCTGACAGCCAAGTAAGAAAGG + Intergenic
1080507008 11:32924698-32924720 TTCTTAAAACCCAATAAGAAGGG + Intronic
1081458908 11:43252898-43252920 TTCTTATATCAGAGGAAGAATGG - Intergenic
1081624469 11:44640943-44640965 TTCTGAGATGCAAGAAAGAATGG + Intergenic
1081833572 11:46135427-46135449 ATCTAAGTTCCAAGAAAGAAAGG + Intergenic
1083178431 11:60968179-60968201 GTCTAAGATTCAAGTAAGAATGG - Intergenic
1084614358 11:70225943-70225965 TTCTAAGATTCAAGGAAGGAGGG + Intergenic
1087902395 11:103656231-103656253 TTCATAGATAGAAATAAGAACGG - Intergenic
1088175082 11:107044530-107044552 TTCTTAGAACCAAGAAAATATGG - Intergenic
1090611078 11:128471301-128471323 TTCTCAGACCCAAGTCAGACTGG - Intronic
1091078122 11:132640362-132640384 TACTTAGAGCCAAGGGAGAAAGG + Intronic
1091307419 11:134545505-134545527 TCCTTAGATCCATTAAAGAATGG + Intergenic
1098808846 12:75058004-75058026 TTCTGGGATACAAGAAAGAAAGG + Intronic
1099637727 12:85236128-85236150 TTCAAAGATCCAAATATGAAAGG + Intronic
1102197880 12:111037099-111037121 TTCTGAGATCCAGGTAGGAGAGG + Intronic
1102730156 12:115102069-115102091 TTATAAGATCTAAGAAAGAAGGG - Intergenic
1103815024 12:123647967-123647989 TTCTTATATCCTGGAAAGAATGG + Exonic
1105627824 13:22130354-22130376 TTCTGAGATTACAGTAAGAAGGG + Intergenic
1105910128 13:24856440-24856462 TTCTGACATCAGAGTAAGAAAGG - Intronic
1108532204 13:51338070-51338092 TTCTTAAAAGCAAGTTAGAATGG + Intronic
1110183102 13:72640819-72640841 TTCTTTGATCCAACAAAGATAGG - Intergenic
1110247083 13:73338760-73338782 TTCTTATTTCCAAATAAGAAAGG - Intergenic
1110444169 13:75558965-75558987 TAAATAGAACCAAGTAAGAATGG + Intronic
1111529152 13:89514297-89514319 TTATTAAATCCAAATAGGAAAGG + Intergenic
1116076944 14:40122779-40122801 TTCTTAGCTCCATGTAAGAAAGG - Intergenic
1118278701 14:64409520-64409542 TTTTTAGATCAAAGTAGGAAAGG - Intronic
1119752239 14:77087758-77087780 TGCTTAGGTCCAAGAAAGTATGG + Intergenic
1123501068 15:20881171-20881193 TTCTTAGCTCCAAATAATAAAGG + Intergenic
1123558320 15:21454879-21454901 TTCTTAGCTCCAAATAATAAAGG + Intergenic
1123594552 15:21892151-21892173 TTCTTAGCTCCAAATAATAAAGG + Intergenic
1124784841 15:32670115-32670137 TTTTTAGATCCTAGTATGAGGGG + Intronic
1125152320 15:36546885-36546907 TGCTTAGATTCAATGAAGAATGG + Intergenic
1126180388 15:45779585-45779607 TTCTTGGTTGCAAATAAGAAAGG - Intergenic
1126706635 15:51412264-51412286 TTCTTAGAGGCAAGTAAGAGTGG - Intergenic
1127579749 15:60327526-60327548 TTCTTAGATGGAAGTGAGTATGG + Intergenic
1127646776 15:60966483-60966505 TTGTAAGCTCCAAGAAAGAAGGG + Intronic
1130658996 15:85815176-85815198 ATGTTAGATCCCAGGAAGAATGG - Intergenic
1130766551 15:86877072-86877094 TTCTCAGATCCATATAAGATAGG + Intronic
1202966670 15_KI270727v1_random:182024-182046 TTCTTAGCTCCAAATAATAAAGG + Intergenic
1133892163 16:9890736-9890758 TTCTCAAATCCCAGTAGGAAAGG - Intronic
1137611711 16:49822485-49822507 TTTTTAAATCCAAGTTAGATGGG + Intronic
1138126686 16:54444646-54444668 TTCTGTGATCTAAGTAAGCATGG + Intergenic
1139343355 16:66286496-66286518 TCCTTAGATCCAGGTGAGAGAGG + Intergenic
1139800200 16:69516147-69516169 TGCTTAGCTTCAAGGAAGAATGG - Intergenic
1141398240 16:83723853-83723875 TGCATAGATCCATGGAAGAATGG + Intronic
1143567988 17:7736649-7736671 CTCTTAGAGGCAAGTCAGAATGG + Intronic
1144561710 17:16325911-16325933 TTTTCAGATCCAAGGAACAAAGG + Exonic
1147777137 17:42910163-42910185 TTCTTAGATCCAATTAACAAGGG + Intronic
1148487173 17:47997970-47997992 TTGTTTCATCCAAGTCAGAATGG + Intergenic
1150037309 17:61817801-61817823 TTCGTAAATTCAAGTTAGAAAGG + Intronic
1153409141 18:4774075-4774097 TGCTTAGGTCCAACAAAGAATGG + Intergenic
1159638991 18:70841150-70841172 TTCTTAGTTCCATTTAATAAAGG + Intergenic
929449094 2:42024823-42024845 TTCTTGCAGCCCAGTAAGAATGG - Intergenic
930780283 2:55217948-55217970 TTTTTTGATTGAAGTAAGAATGG + Exonic
932117920 2:69069982-69070004 TTCTTACATCCCAGAGAGAATGG + Intronic
933356691 2:81219081-81219103 TTTTTAGATCCAATAAATAAGGG + Intergenic
939414382 2:141874969-141874991 TTCTTAAATCCCAGTAAAAATGG + Intronic
942578893 2:177395173-177395195 CTCTTAGAACCAAGTAAGGAGGG + Intronic
943924000 2:193747367-193747389 TTCTTAGATCCCACAAATAAAGG - Intergenic
944552693 2:200859552-200859574 GTCTTACATCCAAGTAAAAAAGG + Intronic
944978079 2:205080533-205080555 TTTTTAGATAAAAGTAACAATGG - Intronic
945459293 2:210086108-210086130 TTATGATATCCAATTAAGAAAGG + Intronic
948416171 2:237806254-237806276 TTCTTAGATACGTCTAAGAAAGG + Intronic
1169424852 20:5487891-5487913 TTTTCAGATACAAGGAAGAAAGG - Intergenic
1169622603 20:7524867-7524889 TTGTTACTTCCAGGTAAGAATGG - Intergenic
1170405568 20:16032498-16032520 GTCTTAAATTCAAGGAAGAAAGG + Intronic
1171938555 20:31301158-31301180 TTGTAAGATCCTAGGAAGAATGG - Intergenic
1174197424 20:48783450-48783472 ATTTTAGATCCAAGTAGCAATGG + Intronic
1177173880 21:17682895-17682917 TTCCTAGATCCAGACAAGAAAGG + Intergenic
1179779622 21:43691113-43691135 TTCTACGATCCAGGGAAGAAAGG - Intronic
1182046352 22:27277254-27277276 TACTTATATCCAGGGAAGAAGGG - Intergenic
949976286 3:9463462-9463484 TTCTGAGAATCAAGTGAGAAAGG + Intronic
950380381 3:12608732-12608754 TTCTTTTATCCAAGGAAGATAGG - Intronic
953478269 3:43225040-43225062 TTCATAGAACCAAAGAAGAATGG - Intergenic
955992220 3:64640754-64640776 GTCTTAGATCCATGTAAAATTGG + Intronic
957261265 3:77905011-77905033 TGCTTAGATTCAATGAAGAATGG + Intergenic
958092915 3:88900394-88900416 ATCTTACATTCAAGCAAGAATGG + Intergenic
959191805 3:103122158-103122180 TTTTAAGAAACAAGTAAGAAAGG - Intergenic
959456252 3:106566252-106566274 TTCTTAGATCTATATGAGAAGGG + Intergenic
962816741 3:139006892-139006914 TTTTTAGAACCACGTAGGAAGGG - Intronic
963590799 3:147256067-147256089 TTTTTATGTTCAAGTAAGAAGGG + Intergenic
966880502 3:184347280-184347302 TTCTTAGTCCCATGTTAGAAAGG + Intronic
968971601 4:3798454-3798476 TTCTCAGATCCAATTAACCATGG - Intergenic
969854753 4:9990241-9990263 TGCTTAGATGCAAGCAAGGATGG + Intronic
970429210 4:15973153-15973175 TTCTTAGATAGAAGTAGGAGGGG - Intronic
972845617 4:42985274-42985296 TTCTTCAATCAAATTAAGAATGG - Intronic
975913158 4:79292780-79292802 TTTTTAGATCAAAGCAAAAAAGG - Intronic
975995806 4:80312556-80312578 TACATAGATCCAAATAAGAGAGG - Intronic
976372848 4:84310099-84310121 TTCTTTGAGCTAAGTAAGACAGG + Intergenic
976551067 4:86396029-86396051 TTCTTAGGTTCACGTAAAAAAGG - Intronic
977465477 4:97379020-97379042 TTTTTAGATCCAAGCTACAAAGG + Intronic
980096221 4:128493764-128493786 TTCTTATTTTCAAATAAGAAAGG + Intergenic
981910300 4:149972019-149972041 TTCTTAGATACAATAAAAAAAGG + Intergenic
985037478 4:185855604-185855626 TTCTAAAAGCAAAGTAAGAAAGG + Intronic
985073053 4:186187281-186187303 TTCTTGGATCTAAATTAGAAAGG + Intergenic
987794571 5:22609432-22609454 TTCTTAGATCCTACTAGGAAAGG - Intronic
990032699 5:51281216-51281238 TGCTTAGATTCAATGAAGAATGG - Intergenic
990755582 5:59065892-59065914 TTCTTAGATCCAATTAAAGAAGG - Intronic
991225960 5:64272621-64272643 TTATTAGATGCAAGAAAGGATGG + Intronic
992158583 5:73978975-73978997 TTCTTAGCTCCAAGAAAGACAGG - Intergenic
992491881 5:77252556-77252578 TTCTTGTATCAAAGTCAGAATGG - Intronic
992868219 5:80979460-80979482 TTCTTAGAACCAATTAAATAGGG - Intronic
993029971 5:82694629-82694651 GTCTTAGACCCTAGTAAGAGGGG - Intergenic
994188351 5:96840093-96840115 TTATTAGATGAAAGGAAGAATGG + Intronic
994218309 5:97164198-97164220 TACTTATATCCAAGTACAAATGG + Intronic
994525230 5:100898927-100898949 TTCTTTGATCCAAATAAGCAGGG - Intronic
995406555 5:111803999-111804021 TTGTTAGATCCAGGGAAAAAAGG - Intronic
997441297 5:133910402-133910424 TTCTAAGATCTAATTTAGAAAGG - Intergenic
999103422 5:149047154-149047176 TTGTTAAAACCAAGGAAGAATGG - Intronic
1000126842 5:158253794-158253816 TTCTTAAATACAAGTAACATGGG + Intergenic
1000818226 5:165950854-165950876 TTCTTAGAATGAAGTGAGAAAGG - Intergenic
1001881599 5:175249530-175249552 TTCCTAGCTCCAAGCAAGGATGG - Intergenic
1002666639 5:180830405-180830427 TTCTTAGATCAAGGGAAGAAAGG + Intergenic
1003996281 6:11543688-11543710 TTCTTAAATCCAAGTAGTACTGG - Intronic
1004757666 6:18630637-18630659 TTCTGAGAACAAATTAAGAAAGG - Intergenic
1007032186 6:38639057-38639079 TTAGTAGATCCAAGGAAGTATGG - Intronic
1008345587 6:50422673-50422695 TTCTTAGAGGCAATTAAAAATGG - Intergenic
1012090463 6:94888083-94888105 TTCTTAGATCCATATAATAAGGG - Intergenic
1013269060 6:108528777-108528799 TTCTTGGATCCACATAAAAATGG + Intergenic
1015032001 6:128606430-128606452 TTCTTAGTTCCAAGGGATAAGGG - Intergenic
1015227459 6:130873812-130873834 TTCTTAGCTCACAGTATGAAGGG - Intronic
1015397115 6:132747140-132747162 TTCTTAGATGGAAGGAAGGAGGG - Intronic
1017200004 6:151742609-151742631 TTATCAGCTCCAAGTAACAAAGG - Intronic
1017485710 6:154900472-154900494 TTCTCTCATCCAAGTAGGAATGG + Intronic
1017774732 6:157672029-157672051 TTCTTAGAGAGAAGGAAGAATGG - Intronic
1018546022 6:164936934-164936956 TTCTTAGATCCATGAGAGAATGG + Intergenic
1019943863 7:4311544-4311566 ATCTTGGATCCCAGGAAGAAAGG + Intergenic
1021676009 7:23081418-23081440 TTCTTCGATCTCAGCAAGAAAGG + Intergenic
1022835073 7:34105675-34105697 TTCACAGTTCCAATTAAGAAAGG + Intronic
1024466574 7:49717510-49717532 TTCTTAGAAAGAAGTAGGAAAGG + Intergenic
1024775149 7:52776057-52776079 TTCTTTAATCCAAGCCAGAATGG + Intergenic
1024840694 7:53583816-53583838 TTCTTACATCCATGAGAGAATGG - Intergenic
1027427620 7:78077431-78077453 TTATTAGATCCAAGCATTAAGGG + Intronic
1027770171 7:82396702-82396724 TTCTTATATCCAAATAATGAAGG + Intronic
1029021988 7:97374419-97374441 GTCTTTGATCCAATTGAGAAAGG + Intergenic
1030551448 7:110966225-110966247 TGCTTAGTTCCCAGTAAAAATGG - Intronic
1030963154 7:115952789-115952811 TACTTAGATCCAGGCAAGAGAGG + Intronic
1031764051 7:125753198-125753220 TTCATATAACAAAGTAAGAAAGG - Intergenic
1031993518 7:128212962-128212984 TTCTTAGATCCCAGTGCCAAGGG + Intergenic
1036753654 8:11458313-11458335 TGCTCAGATCCAAGTGTGAAGGG - Intronic
1040590000 8:48782804-48782826 TTCTTAGGACAAAGTAATAATGG + Intergenic
1040641037 8:49334511-49334533 TGCTTAGATTCAACAAAGAATGG - Intergenic
1040717564 8:50275860-50275882 TTCTTAGATCCAAGTAAGAATGG - Intronic
1041263303 8:56040295-56040317 TTTTTAGATTCAATTAAGGAAGG + Intergenic
1043211366 8:77522722-77522744 TTATTAGTTCCAAGAATGAAGGG + Intergenic
1043295670 8:78659717-78659739 TTCTTAGCTGCAAGAAAGACTGG + Intergenic
1044831548 8:96254868-96254890 TGCTAGGATCCAAGTAAGCAGGG + Intronic
1044839904 8:96328675-96328697 TTCTTAGTTCCAAAAAAGAAAGG - Intronic
1046005688 8:108480465-108480487 TTCTTAGAACTGAGTATGAATGG + Intronic
1047788592 8:128178555-128178577 TGCTTAGATTCAATGAAGAATGG - Intergenic
1050915874 9:11131578-11131600 TTCTTAGAAACAATTAAGGAAGG + Intergenic
1052417338 9:28193219-28193241 TTCCTAGATCTAAGAAGGAAGGG - Intronic
1055675980 9:78661593-78661615 TTCTTATATCAAAGAAAAAAAGG - Intergenic
1185513744 X:682778-682800 TTCTGAGATGCAAGCAGGAATGG + Intergenic
1186236869 X:7521672-7521694 TTATGACTTCCAAGTAAGAAAGG + Intergenic
1187741286 X:22358468-22358490 GTCTGAGATGCAAGAAAGAATGG - Intergenic
1189265040 X:39708765-39708787 TTATTACATCCCATTAAGAAAGG + Intergenic
1189619569 X:42821368-42821390 TTCCTAGATCCAGATAAGGAGGG - Intergenic
1190132330 X:47760187-47760209 CTCATAGATCAAATTAAGAAAGG + Intergenic
1191831704 X:65422190-65422212 TTCATGGATCCAAGTATCAAAGG + Intronic
1192025648 X:67448564-67448586 TTATTTTATCCCAGTAAGAATGG + Intergenic
1192262432 X:69513501-69513523 TTCTTAAAACCAAATAAGACAGG - Intronic
1192379903 X:70604786-70604808 TTCTTAGATTGAAAGAAGAAAGG + Intronic
1193394892 X:80971662-80971684 TTGTTAAATAAAAGTAAGAATGG - Intergenic
1193719665 X:84972384-84972406 TTCACAGATCCAAATAGGAATGG + Intergenic
1194360439 X:92942997-92943019 TTCTTATAGCAAAGCAAGAATGG - Intergenic
1194395612 X:93381323-93381345 TTCTTACTTCCAAGAAACAATGG - Intergenic
1194641660 X:96410127-96410149 TTCTGAAATCCAATAAAGAAAGG + Intergenic
1195799203 X:108688113-108688135 TTCATAGATCAAAGAAAGTAAGG + Intronic
1196726672 X:118901955-118901977 TTCTGAGACCCAAATGAGAACGG + Intergenic
1197103554 X:122686055-122686077 TTGTTACATCCTAGCAAGAATGG - Intergenic
1199121320 X:144057499-144057521 GTCTTACATTCAAGTAAAAAAGG - Intergenic
1199160341 X:144602320-144602342 GTCTGAGATACAAGAAAGAATGG - Intergenic
1200668641 Y:6058815-6058837 TTCTTATAGCAAAGCAAGAATGG - Intergenic
1201636219 Y:16126018-16126040 CTGTTAGATCAAAGAAAGAAAGG + Intergenic