ID: 1040717568

View in Genome Browser
Species Human (GRCh38)
Location 8:50275906-50275928
Sequence CTGGTTTCTCTTGAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040717564_1040717568 23 Left 1040717564 8:50275860-50275882 CCATTCTTACTTGGATCTAAGAA 0: 1
1: 0
2: 2
3: 25
4: 183
Right 1040717568 8:50275906-50275928 CTGGTTTCTCTTGAGGAGGATGG No data
1040717563_1040717568 26 Left 1040717563 8:50275857-50275879 CCACCATTCTTACTTGGATCTAA 0: 1
1: 0
2: 1
3: 13
4: 182
Right 1040717568 8:50275906-50275928 CTGGTTTCTCTTGAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040717568 Original CRISPR CTGGTTTCTCTTGAGGAGGA TGG Intronic
No off target data available for this crispr