ID: 1040717568 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:50275906-50275928 |
| Sequence | CTGGTTTCTCTTGAGGAGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1040717564_1040717568 | 23 | Left | 1040717564 | 8:50275860-50275882 | CCATTCTTACTTGGATCTAAGAA | 0: 1 1: 0 2: 2 3: 25 4: 183 |
||
| Right | 1040717568 | 8:50275906-50275928 | CTGGTTTCTCTTGAGGAGGATGG | No data | ||||
| 1040717563_1040717568 | 26 | Left | 1040717563 | 8:50275857-50275879 | CCACCATTCTTACTTGGATCTAA | 0: 1 1: 0 2: 1 3: 13 4: 182 |
||
| Right | 1040717568 | 8:50275906-50275928 | CTGGTTTCTCTTGAGGAGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1040717568 | Original CRISPR | CTGGTTTCTCTTGAGGAGGA TGG | Intronic | ||
| No off target data available for this crispr | |||||