ID: 1040725223

View in Genome Browser
Species Human (GRCh38)
Location 8:50374705-50374727
Sequence TGAGCAGTTCACATTGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040725223_1040725225 2 Left 1040725223 8:50374705-50374727 CCCAAATCAATGTGAACTGCTCA 0: 1
1: 0
2: 0
3: 19
4: 174
Right 1040725225 8:50374730-50374752 ATTTATGTGTTTTTCATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040725223 Original CRISPR TGAGCAGTTCACATTGATTT GGG (reversed) Intronic
900751119 1:4398317-4398339 TGAGCAGCTCAGATTGTTCTAGG + Intergenic
905141737 1:35851425-35851447 TGACCAGTTCACTTTGCTTTTGG + Intronic
905752864 1:40481135-40481157 AGAGCAGGTAGCATTGATTTGGG + Intronic
907692708 1:56686031-56686053 TCATCATTTCACATTGAATTTGG - Intronic
909652035 1:77986585-77986607 TAATCAGTTCAAATTGACTTTGG + Intronic
909731327 1:78894942-78894964 TCAGAAGTTCACATTCATTTTGG + Intronic
914732153 1:150381040-150381062 TTAGCAGTTTACATTCTTTTTGG - Intronic
914832775 1:151182661-151182683 TGAGAAGTGCCCATTGGTTTTGG - Intronic
916157643 1:161871068-161871090 TGAGTAGTCAACATTTATTTAGG - Intronic
918227451 1:182497168-182497190 GAAGCAGTTCACATTGATGTAGG - Intronic
1062784296 10:249270-249292 TGAGCAGTACACAGTAATATGGG - Intronic
1062864038 10:834717-834739 TTAGCAGTAGACATTGATTTTGG - Intronic
1063016305 10:2081102-2081124 AGAGCATTGCACTTTGATTTGGG - Intergenic
1065510874 10:26477166-26477188 TGATCAATTCATCTTGATTTTGG + Intronic
1066253694 10:33657921-33657943 TAAACAGATCACATTCATTTTGG - Intergenic
1066785325 10:38997357-38997379 AAAGTAGTACACATTGATTTAGG - Intergenic
1067994876 10:51260723-51260745 TAATCACATCACATTGATTTCGG - Intronic
1070479450 10:76868050-76868072 AAAGCAGTTAACATTGATTCTGG + Intergenic
1076922452 10:133461385-133461407 TGGGCTCTTCTCATTGATTTTGG + Intergenic
1077946083 11:6900431-6900453 TGAGCAATTTACATTGCTTATGG + Intergenic
1081244438 11:40746880-40746902 TGAGCAGTACACATTAACATTGG - Intronic
1083609520 11:63998386-63998408 GCAGCAGTTCACATTTATTGAGG - Exonic
1087413749 11:97825908-97825930 TGAACAATTCACATTCATTTGGG - Intergenic
1087475634 11:98630334-98630356 TGACCAGTTAACATTCAGTTTGG - Intergenic
1087852198 11:103045102-103045124 TGAGCAGTGCCTATTGATTCAGG - Intergenic
1088166308 11:106941875-106941897 TAAGCATTTCATATTCATTTTGG + Intronic
1088627509 11:111740905-111740927 TGAGCTGTTCAAATTCAGTTAGG + Intronic
1090630906 11:128646487-128646509 TGAGGAGTTGAGATTCATTTAGG - Intergenic
1092919675 12:13220106-13220128 TAAGCATTTGACATTGATGTGGG + Intergenic
1094277996 12:28700683-28700705 TGAGAAGTTCACAATATTTTAGG + Intergenic
1096821182 12:54236119-54236141 TAAGAAGTTGACATTAATTTCGG - Exonic
1097239353 12:57564374-57564396 TGAGCAGGTCACATTAGTATGGG + Intronic
1099234191 12:80062780-80062802 TGAGCAGATCAATTTGAGTTGGG - Intergenic
1103689220 12:122757246-122757268 AGAGCAGCTCAAATTCATTTAGG + Intronic
1108868489 13:54951319-54951341 TGACTATTTTACATTGATTTTGG - Intergenic
1109724404 13:66320406-66320428 TGTGCAGTTCACTTTTATTAGGG - Intronic
1110594600 13:77306395-77306417 TTAACAGTTCAACTTGATTTAGG + Intronic
1114214660 14:20647278-20647300 TGACCAGTTGACATTGGCTTTGG + Intergenic
1122397653 14:101445098-101445120 TTAGCAGTTCACATTGTATGTGG + Intergenic
1123554523 15:21414585-21414607 TAAGCTGCTCACATTGATATTGG - Intronic
1124084080 15:26530631-26530653 TAAGCAGAGGACATTGATTTGGG - Intergenic
1124989862 15:34661264-34661286 TGTACAATTCACATTGATTTTGG - Intergenic
1127610310 15:60630230-60630252 TCAGCAGTTCACAATGAACTTGG - Intronic
1127710892 15:61597014-61597036 TAAGCAGTTCTAATGGATTTTGG - Intergenic
1128782936 15:70374938-70374960 GGAGCAGATCACTTTGATTTGGG + Intergenic
1129565809 15:76622304-76622326 TGAGCAGTTAACATTTAAATTGG - Intronic
1130532276 15:84756555-84756577 TGAGCAGTTCAGATTTTTCTGGG + Intronic
1135286119 16:21194678-21194700 TGAGCAGTTCTGATTGATGGTGG - Intergenic
1135882767 16:26275192-26275214 TGAGGACTTCAAATTGATCTTGG - Intergenic
1136418058 16:30115444-30115466 TCAGCAGTTCACATAGCTGTGGG - Intronic
1140409509 16:74733503-74733525 TGTGCACTTGACCTTGATTTAGG + Intronic
1143129631 17:4669577-4669599 GGTGAAGTTGACATTGATTTTGG - Intergenic
1143285167 17:5783651-5783673 TGGGCTGTTCACAATGATTTGGG + Intronic
1143694028 17:8597066-8597088 TGTGTAGTTCAAATTGATGTAGG + Intronic
1144139107 17:12330419-12330441 GGCACAGTTCACATTCATTTGGG - Intergenic
1145996684 17:29108883-29108905 TGAGTAACGCACATTGATTTTGG + Intronic
1146649017 17:34595098-34595120 TCATCAGTTCACACAGATTTTGG - Intronic
1150270402 17:63860739-63860761 TGAGCAGGTCACATTAATGTCGG - Intergenic
1150993080 17:70283467-70283489 TGAGCAGATCAGGTTGATATGGG - Intergenic
1153761881 18:8339574-8339596 TGAGCAATCCACAGTGATCTTGG + Intronic
1155324120 18:24648990-24649012 AAAGCAGTTCACATTCATATGGG - Intergenic
1155524945 18:26706527-26706549 TAAACAGTGCACATTGCTTTGGG - Intergenic
1155974970 18:32119047-32119069 TGAGCTTTTCACATTTATTTGGG + Intronic
1165642617 19:37403099-37403121 TCTGCAGTTCACCTTAATTTTGG - Intergenic
1166433076 19:42742500-42742522 TGAGCAGTGCACATGGGCTTGGG + Intronic
1167786003 19:51636762-51636784 TGAGGAGGTGACATTGATCTTGG + Intronic
926624676 2:15081244-15081266 TGAGGAGTTAACAATGATATGGG - Intergenic
926636966 2:15191182-15191204 TGATGAGTTCATAATGATTTGGG + Intronic
930950311 2:57134259-57134281 TGAGATGTTCTCATTGTTTTTGG + Intergenic
931512254 2:63012790-63012812 TGAGCTGTTGACATTCTTTTGGG + Intronic
933300883 2:80539827-80539849 TGAGCAATTTAGATTGATCTGGG - Intronic
934123117 2:88859268-88859290 TGATCAATTCACTTTGAATTTGG - Intergenic
939128815 2:138209345-138209367 TGAGCAGTTTTCATTGAGTAAGG - Intergenic
939226565 2:139372070-139372092 TGAGAAGATTACATTGATTTGGG + Intergenic
939488363 2:142845941-142845963 TGAGCATTGCACTTTAATTTTGG + Intergenic
943172467 2:184420702-184420724 TGAGTAATTCACATAGATTTTGG + Intergenic
943828147 2:192422678-192422700 TTACCATTTCAAATTGATTTAGG + Intergenic
1168985460 20:2044676-2044698 AGAGAAGCTCACAGTGATTTTGG - Intergenic
1169703172 20:8472006-8472028 TTGGCAGTTCACATTGCTTCAGG + Intronic
1170517529 20:17147348-17147370 TGAGCATTTTATATTGTTTTTGG - Intergenic
1174701725 20:52616293-52616315 TGAGCATTTCTCTTTGAATTAGG + Intergenic
1176657038 21:9596335-9596357 TGAGAAGTTCTGGTTGATTTGGG + Intergenic
1181392752 22:22595438-22595460 TGAGAAGTTCAGAATGATCTGGG - Intergenic
1185109440 22:48892925-48892947 TGGGCAGTGCCCATTGATGTGGG - Intergenic
1185395529 22:50585305-50585327 AAAGCAGTTCACATTTATATGGG + Intronic
951081304 3:18453433-18453455 TCAGCAATCCACATGGATTTGGG + Intergenic
951106482 3:18749756-18749778 TGAGGAGGTGACATTGATTCTGG + Intergenic
951675540 3:25236721-25236743 TTAGCATTTCATATTGAATTTGG + Intronic
953924351 3:46974484-46974506 TGAGCTGTTCGCTTGGATTTAGG - Intronic
954421609 3:50421853-50421875 TGAGCAGTTCCCAGTCACTTGGG - Intronic
955739052 3:62070255-62070277 TGGCCATTTCACAGTGATTTTGG + Intronic
956021281 3:64935874-64935896 TGAACTGTTCACTTTAATTTTGG - Intergenic
956865020 3:73361092-73361114 TCAGCAGGCCACATAGATTTTGG + Intergenic
958033951 3:88149019-88149041 TGATCAGTTGACATTTAATTGGG - Intronic
958065071 3:88534268-88534290 TAAGCAGCTCACATTAATCTGGG - Intergenic
958664727 3:97121799-97121821 GGAGCAGATCACTTTGCTTTAGG - Intronic
959599420 3:108163155-108163177 TGAGCAGGTTACTTTGATATGGG - Intronic
961287313 3:125816574-125816596 AGAGCAATTCACGTTGATCTGGG - Intergenic
962705109 3:138035692-138035714 TGCGCATTTCACGTTTATTTGGG - Intergenic
964642098 3:158919399-158919421 AGGGCAGTTCTCATTGATTGAGG + Intergenic
965518839 3:169652411-169652433 AGAGGAGTTCCCATTGACTTAGG + Intronic
966464357 3:180213202-180213224 TGAGCAGTTCACAGTGTGTTGGG - Intergenic
966465378 3:180225723-180225745 TGAGCTGATCACTTTGTTTTAGG - Intergenic
967729323 3:192893024-192893046 TGAGCAGTTTACATTGACTGTGG - Intronic
967803540 3:193691306-193691328 TGAGCAGTTCACATTTGTGGAGG + Intronic
970719474 4:18969668-18969690 TGAGCAGTCCATATTGGTCTTGG - Intergenic
975765748 4:77666047-77666069 TGAGCAGTTCAAAATAATTCAGG - Intergenic
976639091 4:87318837-87318859 TGAACAATTAACATTCATTTTGG + Intronic
977636165 4:99300920-99300942 TTAGCATTTCATTTTGATTTTGG + Intergenic
977638211 4:99325066-99325088 TTAGCATTTCATTTTGATTTTGG + Intergenic
979681732 4:123467397-123467419 TGAGGAGCTCACAGTTATTTGGG - Intergenic
980320004 4:131259195-131259217 TGACCAATCTACATTGATTTTGG + Intergenic
980709751 4:136549568-136549590 AGAGAAATTCACATAGATTTGGG - Intergenic
982294572 4:153813808-153813830 TCTGCAGTTCACATGGCTTTTGG - Intergenic
983525675 4:168758350-168758372 GCAGCATTTCACATTCATTTTGG - Intronic
985361380 4:189179292-189179314 TAAACAGCTCACATTGATTGAGG + Intergenic
985364522 4:189213431-189213453 TGATCTGTTCACATTGGTTTTGG + Intergenic
986602513 5:9487220-9487242 TAAGAAGTTCACATTAATTATGG + Intronic
986704336 5:10442499-10442521 TGAGCATTTTGCAATGATTTCGG - Intronic
986800272 5:11252806-11252828 TGAGGAGTACACATTCATTTTGG - Intronic
990188836 5:53235351-53235373 TGAGCAGTTCAAAGCAATTTGGG + Intergenic
990339039 5:54804198-54804220 AGAGCAGTTAAAATTGAGTTGGG + Intergenic
990358411 5:54994255-54994277 AGAGCACTTCACATTCAATTAGG + Intronic
992346638 5:75885856-75885878 AGAGCATTTCCCATTGATTTGGG - Intergenic
992615321 5:78541557-78541579 TGAGCTGGTCACAAAGATTTTGG + Intronic
994041951 5:95268768-95268790 GGTGAAGTTCACATTTATTTAGG - Intronic
994057067 5:95429091-95429113 TGAACAATTCACATTTATGTTGG - Intronic
996465780 5:123801057-123801079 TGTGAAGTTCACATTTAATTGGG - Intergenic
996598790 5:125236844-125236866 TATGCAAATCACATTGATTTGGG - Intergenic
997237952 5:132285105-132285127 GGAGCAGTTTGCATTCATTTGGG - Intronic
997317985 5:132954116-132954138 TGAGCAGTTCCCAATCTTTTTGG + Intronic
999096249 5:148980401-148980423 TGAGGAGCTCACATTGTATTGGG + Intronic
999644060 5:153700716-153700738 TGAGCACTTAACATTGACCTGGG - Intronic
1001187355 5:169587237-169587259 TGGGCAGTTCAGATTCATTAGGG - Intronic
1001667608 5:173446397-173446419 TGAGCATTGACCATTGATTTGGG + Intergenic
1002947583 6:1777929-1777951 TCAGCATTTCACCTTTATTTGGG - Intronic
1005234124 6:23740272-23740294 TTAGCAGTCCTCATTGAATTGGG + Intergenic
1006721768 6:36159053-36159075 TGAGCACTTCATATAAATTTGGG - Intergenic
1010392798 6:75356292-75356314 TGAGCAGCTCTCTTTTATTTTGG - Intronic
1010676140 6:78745683-78745705 TGAGCACTGCACATTGGTATTGG + Intergenic
1012053998 6:94381872-94381894 TGATCAGTTGACTTTTATTTAGG - Intergenic
1014387230 6:120817375-120817397 GGAGCAGTTAACATTTATTGAGG + Intergenic
1014575835 6:123071092-123071114 TGTGGAGTTCACATTGCTATTGG - Exonic
1015887422 6:137932164-137932186 TGTGGAGTTCACATTTATTGCGG - Intergenic
1017605464 6:156128110-156128132 TGAGCATTACACATAGGTTTAGG + Intergenic
1021013707 7:15504877-15504899 TGACCATTTCACATTTATTGAGG - Intronic
1021035876 7:15797472-15797494 TGAGAAGTTCAGTTTGGTTTAGG + Intergenic
1021911430 7:25389255-25389277 AGAGCAGTTCAGAATGTTTTGGG - Intergenic
1022235336 7:28455317-28455339 AGAGCAGTTCATGATGATTTGGG + Intronic
1022660661 7:32363489-32363511 CAAGCAGTTCAGATTAATTTAGG - Intergenic
1022881727 7:34594964-34594986 TGAGAAGTTCACAGTTATTGGGG - Intergenic
1024808060 7:53171109-53171131 TAAGAAGTTCACATTCATGTGGG - Intergenic
1027920283 7:84384608-84384630 TGTGCAGTACACAGTGATTCAGG + Intronic
1028687869 7:93612758-93612780 GAAGCAGTTCACCTTCATTTGGG + Intronic
1029069725 7:97885552-97885574 AGAGCAATTCACATTGACCTGGG + Intergenic
1029889192 7:103908223-103908245 TGAGAAGTTCACTTTAATTTTGG - Intronic
1030049542 7:105525414-105525436 TCAGCAGTTCCCAATGTTTTTGG - Intergenic
1031754243 7:125618240-125618262 TGAGCAGTATACATTGGTATTGG + Intergenic
1032601256 7:133298274-133298296 TGAGCATTTCTAATGGATTTGGG + Intronic
1037419716 8:18689220-18689242 TGAGCAGCTCACATTCAGTCGGG + Intronic
1040705462 8:50121364-50121386 TGAGCAGTGCACATAGAACTAGG - Intronic
1040725223 8:50374705-50374727 TGAGCAGTTCACATTGATTTGGG - Intronic
1041495027 8:58476784-58476806 TGAGGACTTAATATTGATTTTGG - Intergenic
1045349499 8:101325122-101325144 TGAAAAGTTCACTTTGATTGAGG + Intergenic
1046540015 8:115567732-115567754 TGAGAAGTCCACATTGATAGAGG - Intronic
1046975189 8:120267124-120267146 AGAGCAGTTAACATTCATTAAGG + Intronic
1047190098 8:122671090-122671112 TGAGAAATTCACAGTCATTTTGG - Intergenic
1050165196 9:2758092-2758114 TGGGCAATCCACATTCATTTTGG + Intronic
1050301276 9:4261256-4261278 AGAGCTGCTCACATTGAATTGGG - Intronic
1056926190 9:90836592-90836614 TGAGCATCACACAGTGATTTAGG - Intronic
1057946626 9:99335775-99335797 TGGGCAGTTGACACTGAGTTTGG + Intergenic
1059029651 9:110677344-110677366 TGAGGAGGTCATGTTGATTTTGG - Intronic
1059823110 9:117996121-117996143 AGAGCAGTTCCGATTGATGTGGG + Intergenic
1060354452 9:122891946-122891968 TGAGCACTTAACAGTGATTAAGG - Intronic
1061437810 9:130577524-130577546 TGAGCAGGTCACTTATATTTGGG - Intergenic
1061776962 9:132972045-132972067 TGGGCAGATCTCATGGATTTAGG + Intronic
1203634746 Un_KI270750v1:99807-99829 TGAGAAGTTCTGGTTGATTTGGG + Intergenic
1203634757 Un_KI270750v1:99875-99897 TGAGAAGTTCTGGTTGATTTGGG + Intergenic
1187822128 X:23298802-23298824 TGGGCATTTCAAATTGGTTTTGG - Intergenic
1188356595 X:29199451-29199473 TGAGCAGTTCCCAGTCTTTTTGG + Intronic
1188766858 X:34103530-34103552 TGAGAAGTTCACATTCAAATTGG - Intergenic
1189083048 X:37994613-37994635 TGAGCAGCTCAGATGGATCTTGG + Intronic
1189520258 X:41759602-41759624 GGGGCATTTCTCATTGATTTTGG - Intronic
1190580784 X:51892091-51892113 TGTGCAGTTCACATTTGTTCTGG - Intronic
1190585061 X:51931875-51931897 TGTGCAGTTCACATTTGTTCTGG - Intergenic
1190773250 X:53532584-53532606 TGAGCAGTTCACCAGGAATTGGG - Exonic
1191903278 X:66061035-66061057 TGAGCAGTATACATTGATCATGG + Intergenic
1193906481 X:87251889-87251911 AGAGCAGTTTACATTTGTTTAGG + Intergenic
1196016005 X:110940959-110940981 TAAGCAGTTGACAGTTATTTGGG - Intergenic
1196397666 X:115283130-115283152 CTAGCAGTTGACATTGATTTGGG - Intergenic
1196894300 X:120319776-120319798 TGAGCAGTGGGCATGGATTTAGG - Intergenic
1198247678 X:134846662-134846684 TGAGCAGTTATCCCTGATTTTGG + Intronic
1198605772 X:138335006-138335028 TTAGCAATTCATATTAATTTGGG - Intergenic
1199661993 X:150060656-150060678 TGAGCATCTCACAGTGATTGTGG - Intergenic