ID: 1040727345

View in Genome Browser
Species Human (GRCh38)
Location 8:50398285-50398307
Sequence CGCCCTGTATGATGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040727345_1040727348 -10 Left 1040727345 8:50398285-50398307 CCATCTGCCCATCATACAGGGCG 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1040727348 8:50398298-50398320 ATACAGGGCGTTAGCACGCCTGG No data
1040727345_1040727351 18 Left 1040727345 8:50398285-50398307 CCATCTGCCCATCATACAGGGCG 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1040727351 8:50398326-50398348 TCCAGACATCTCTCCTGCAGCGG No data
1040727345_1040727353 28 Left 1040727345 8:50398285-50398307 CCATCTGCCCATCATACAGGGCG 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1040727353 8:50398336-50398358 TCTCCTGCAGCGGCCCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040727345 Original CRISPR CGCCCTGTATGATGGGCAGA TGG (reversed) Intronic
904434302 1:30484313-30484335 TGTCCTGTAGGAAGGGCAGAGGG - Intergenic
907853561 1:58279857-58279879 GGCTCTGACTGATGGGCAGAAGG - Intronic
911368134 1:96964886-96964908 CTCCCTGTCTGATGGGCGGATGG + Intergenic
912562466 1:110560624-110560646 GGCCCTGAGTGATGGGCACATGG - Intergenic
919847716 1:201651960-201651982 TTCCCTGTGTGAAGGGCAGAGGG + Intronic
920401115 1:205676911-205676933 GGCCCTGTTTGCTGGGCAGCAGG - Intronic
1063929114 10:11011382-11011404 GGCCCTGAAGGATGGGCAGATGG + Intronic
1066596764 10:37059444-37059466 CGTCTTGTATGAGGGGAAGAGGG + Intergenic
1069057625 10:63861257-63861279 TTCCCTGTATGTTGGGCAGCTGG + Intergenic
1071363781 10:84878122-84878144 CTCCCTGCAGGATGGCCAGAGGG + Intergenic
1076058496 10:127394887-127394909 CCACCTGTGTGATGGGCGGAAGG - Intronic
1081803663 11:45877297-45877319 TGCCCAATATGATGGGGAGAGGG + Intronic
1085947071 11:81284816-81284838 CCCCCTGTAGGAGGGGGAGAAGG - Intergenic
1091800675 12:3322815-3322837 AGCCCTGGGTGATGGGAAGATGG + Intergenic
1101742945 12:107515349-107515371 GGCCCTGAATGTTGGGGAGAAGG - Intronic
1102466121 12:113131727-113131749 AGCCCTGTATGATGGGATGGAGG - Intronic
1103898742 12:124292272-124292294 AGCGCTGTAGGAAGGGCAGAGGG - Intronic
1113396898 13:109956205-109956227 TGCTCTGTATGATTGGTAGAGGG + Intergenic
1115220466 14:31053354-31053376 CCCCCGGGATGATGGCCAGAGGG + Intronic
1118316594 14:64729682-64729704 GGCCCCTTAAGATGGGCAGAGGG + Intronic
1121649558 14:95547746-95547768 CACTCTGTATGCTGGCCAGAGGG - Intergenic
1123700538 15:22911611-22911633 GGCCCTGTCTGCTGGGCAGATGG - Intronic
1128570374 15:68729283-68729305 CGCAGTGTGTAATGGGCAGAGGG - Intergenic
1128783694 15:70379457-70379479 TGCCCTCTAAGATGGGCAGAGGG - Intergenic
1130960015 15:88653031-88653053 CACCCTGTGGGAAGGGCAGAGGG + Intronic
1131647708 15:94363205-94363227 CACATTGTATGCTGGGCAGAAGG + Intronic
1140481047 16:75263088-75263110 CGCCCTGTGTGCTGGGCACTGGG - Intronic
1143600085 17:7939432-7939454 CACCTTGTATGAGGGTCAGAGGG + Intronic
1152592436 17:81220292-81220314 GGCCCTGGATGATGGACAGGTGG + Intronic
1152668018 17:81582784-81582806 GTCCCTGTGTGATGGGCAGGAGG + Intronic
1155638690 18:27986036-27986058 AGCCCTGAATAATGGGCAGGAGG - Intronic
1157328952 18:46689215-46689237 GGCCCTGAATGAGTGGCAGAAGG - Intronic
1161614331 19:5261510-5261532 CTCCCTGGATCATGAGCAGAGGG - Intronic
1163555241 19:17988396-17988418 CTCCCTGTGTGCAGGGCAGAGGG - Exonic
1164601853 19:29567715-29567737 GGCCTTGTGTGATGGGCACAGGG + Intergenic
1166819464 19:45568662-45568684 CCCCCAGGATGCTGGGCAGATGG - Intronic
1167492780 19:49801814-49801836 CGCCCTGGACGATGGCCGGAGGG + Exonic
927515681 2:23670394-23670416 CGACCGGTGTGATGGGCAGGGGG + Intronic
931269002 2:60685542-60685564 CCCCCTCTCAGATGGGCAGAGGG + Intergenic
931721321 2:65069601-65069623 TCCCCTGTATGGGGGGCAGAAGG + Exonic
931865117 2:66401243-66401265 TTCCCTGTATCTTGGGCAGAAGG + Intergenic
936269533 2:111038276-111038298 AGCCCTGCAACATGGGCAGATGG - Intronic
937308220 2:120885167-120885189 CGGTCTGCATGATGTGCAGAAGG - Intronic
937880763 2:126862893-126862915 GGCCATGTATGATGGGTAGTGGG - Intergenic
947815551 2:233034178-233034200 CCCCTTGTATGACGCGCAGACGG + Exonic
948617773 2:239212577-239212599 GTCCCTGTATGGGGGGCAGAAGG - Intronic
948669587 2:239559443-239559465 AGCCCTGGATGAAGTGCAGAGGG - Intergenic
1179022674 21:37654572-37654594 GGCCCTGCATGGTGGCCAGAGGG - Intronic
1184492888 22:44820425-44820447 CGTCCTGTGTGATGGGCGGGAGG - Intronic
1184498872 22:44860020-44860042 CGCCCTGTCTGACAGGCAGGAGG - Intronic
1184918798 22:47591163-47591185 GGCCCGGAATGCTGGGCAGAGGG + Intergenic
1185068639 22:48644434-48644456 TGCCCTGCACCATGGGCAGAAGG + Intronic
954464862 3:50648411-50648433 CTCCCTGTGGGATGGGCAGATGG + Exonic
954580947 3:51702662-51702684 CTTCCTGTATGATGGGGAGAGGG - Intronic
954625410 3:52019632-52019654 AGTCCTGTGTGAGGGGCAGAGGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
959350881 3:105261420-105261442 TGCCCTGTATGATAATCAGAAGG - Intergenic
961004361 3:123395065-123395087 GGCCTTGTGTGATGTGCAGAAGG + Intronic
965516779 3:169630037-169630059 CTCCCAGCATGATGGGCAGATGG + Intronic
967019028 3:185506368-185506390 CTCACTGTAGGATGGGTAGATGG - Exonic
968190171 3:196661458-196661480 GGCCCTGCAGCATGGGCAGACGG + Exonic
986461991 5:7982264-7982286 CTCCCTGCATGATGGGCAGCCGG + Intergenic
994236502 5:97369241-97369263 CGCAGTGGTTGATGGGCAGATGG + Intergenic
998518795 5:142781528-142781550 CCCCAGGTGTGATGGGCAGATGG - Intronic
998823859 5:146081616-146081638 CTCCCTGCATGAAGAGCAGATGG - Exonic
999253275 5:150195172-150195194 CGCCCTGCACGGTGGGCAGAGGG + Intronic
999475221 5:151892039-151892061 CTTCTTGTATGATGGGAAGAAGG - Intronic
1000187510 5:158873969-158873991 CAACCTGTATGATGGAAAGAAGG + Intronic
1002642725 5:180638106-180638128 AGCACTGTGTGTTGGGCAGAGGG - Intronic
1003167784 6:3696485-3696507 CTCCCCGCATGATGGACAGAGGG + Intergenic
1005583181 6:27251917-27251939 AGTGCAGTATGATGGGCAGACGG + Exonic
1006364876 6:33609556-33609578 CACCCTGGATGAGGGTCAGAAGG + Intergenic
1006514261 6:34537329-34537351 CCCCGTGTGTGATGGGAAGAGGG - Intergenic
1007274337 6:40662492-40662514 CGCCCTGTGTGTTCAGCAGAAGG - Intergenic
1010380404 6:75217401-75217423 CGCCCTGTATGATAGGAAAGAGG - Intergenic
1012443592 6:99285953-99285975 TGCCTTGTATGATTGGCAGCTGG - Intronic
1013094063 6:106928235-106928257 CCCCCTTCATGATGGGAAGAGGG + Intergenic
1015955695 6:138595874-138595896 CGATCTGTATAATTGGCAGAGGG + Intronic
1024056503 7:45662910-45662932 AGCCCTGTCTGGGGGGCAGATGG - Intronic
1032026686 7:128448300-128448322 GGCCCTGGAAGTTGGGCAGAGGG - Intergenic
1032984775 7:137325715-137325737 CTCCATGTATGATTGGCAGAAGG + Intronic
1037523864 8:19706092-19706114 GGCCCTGTATGATTGGGAGGTGG - Intronic
1039429095 8:37511718-37511740 AGCTCTGTATGATGGGCTGGGGG + Intergenic
1040727345 8:50398285-50398307 CGCCCTGTATGATGGGCAGATGG - Intronic
1043506965 8:80911713-80911735 CGGCCTGGAAGCTGGGCAGAGGG - Intergenic
1046226075 8:111283072-111283094 TGCTCTATATTATGGGCAGAGGG - Intergenic
1048878237 8:138853228-138853250 TGCCCTGAATGATGGGGCGAGGG + Intronic
1049340657 8:142110788-142110810 TGCCCTGTCTGCTGGTCAGAGGG - Intergenic
1050335031 9:4582531-4582553 TGCCCTGAAGGATGGACAGAAGG - Intronic
1050678797 9:8086181-8086203 GGCTCTGCATGATGGGCTGATGG + Intergenic
1203782662 EBV:109310-109332 CGCAGTGTAGGATGGGTAGATGG + Intergenic
1195688599 X:107605977-107605999 CCCTCTGTGTGATGGGCACATGG + Intergenic