ID: 1040743256

View in Genome Browser
Species Human (GRCh38)
Location 8:50605678-50605700
Sequence AACAATATGAAGTTAAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040743255_1040743256 -5 Left 1040743255 8:50605660-50605682 CCTCTTCAGTACTTTCTCAACAA 0: 1
1: 0
2: 0
3: 17
4: 262
Right 1040743256 8:50605678-50605700 AACAATATGAAGTTAAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040743256 Original CRISPR AACAATATGAAGTTAAAGCC AGG Intronic
No off target data available for this crispr