ID: 1040743624

View in Genome Browser
Species Human (GRCh38)
Location 8:50612177-50612199
Sequence AGAAAGCACAAAGGTTGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040743624_1040743627 17 Left 1040743624 8:50612177-50612199 CCTTGTCAACCTTTGTGCTTTCT No data
Right 1040743627 8:50612217-50612239 TTTATCTCCATAGTAACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040743624 Original CRISPR AGAAAGCACAAAGGTTGACA AGG (reversed) Intronic