ID: 1040750402

View in Genome Browser
Species Human (GRCh38)
Location 8:50698776-50698798
Sequence CACATCCCAAGGTAGATCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040750395_1040750402 9 Left 1040750395 8:50698744-50698766 CCCAGAGCAGGTACTTCTTACAG 0: 1
1: 0
2: 0
3: 11
4: 144
Right 1040750402 8:50698776-50698798 CACATCCCAAGGTAGATCTAGGG No data
1040750396_1040750402 8 Left 1040750396 8:50698745-50698767 CCAGAGCAGGTACTTCTTACAGT 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1040750402 8:50698776-50698798 CACATCCCAAGGTAGATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040750402 Original CRISPR CACATCCCAAGGTAGATCTA GGG Intronic
No off target data available for this crispr