ID: 1040750540

View in Genome Browser
Species Human (GRCh38)
Location 8:50700695-50700717
Sequence GGAACGATAAATCATCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040750540 Original CRISPR GGAACGATAAATCATCTTGA GGG (reversed) Intronic
900037507 1:429311-429333 GGAAAGATATATCATGTTCATGG - Intergenic
903636907 1:24825946-24825968 GGGAAGATTAATCAGCTTGAAGG - Intronic
906272997 1:44496183-44496205 GGAAGGACAAATCAATTTGAAGG + Intronic
914972244 1:152317960-152317982 GGATCAATAAAACATGTTGATGG - Intronic
917702623 1:177596669-177596691 GGGACCATAAATCATGGTGAGGG + Intergenic
919120132 1:193329326-193329348 GGAAAAATATATCATCTTCATGG - Intergenic
924863582 1:247953170-247953192 TGGACGATAATTCCTCTTGATGG + Intronic
1062926162 10:1317028-1317050 GGAAGGAAAAATCATTTTTATGG + Intronic
1063349529 10:5341336-5341358 GTAACGGTAAATCTTCTTGGGGG + Intergenic
1070206545 10:74268863-74268885 GGAAATATAAATTATCTTTAAGG + Intronic
1072841710 10:98782375-98782397 GGAAAGATATATGATGTTGATGG + Intronic
1081291603 11:41332664-41332686 AGAAGGATAAAACATCTTCATGG - Intronic
1090515485 11:127422025-127422047 GCAATAAGAAATCATCTTGAAGG - Intergenic
1095235867 12:39794912-39794934 GGAAAAAGAAATCATCTTCAAGG - Intronic
1097677353 12:62617100-62617122 GGAACTATAAGTCAGCATGAGGG - Intergenic
1101101243 12:101395234-101395256 GGAAAGATAATTCATTTTAAGGG + Exonic
1103168050 12:118787688-118787710 ACAGCGATAAATCATTTTGATGG - Intergenic
1107051678 13:36057280-36057302 GAAAGAATAAATCATTTTGAAGG - Intronic
1110315455 13:74101206-74101228 GGAAGAGTAAATCATCTTTAGGG - Intronic
1114177037 14:20331377-20331399 CGAAAGGAAAATCATCTTGATGG - Intronic
1115096678 14:29646098-29646120 GGAAAGATAAACCATATTCATGG + Intronic
1116431627 14:44852698-44852720 GGAAAGATATCCCATCTTGATGG - Intergenic
1118086234 14:62420794-62420816 GGAAGAATAAATCTTCTGGATGG - Intergenic
1118977535 14:70690646-70690668 GGAACTATAAATATTCATGAAGG + Intergenic
1119148144 14:72334472-72334494 GAAACCATCAATCACCTTGATGG + Intronic
1119548664 14:75492340-75492362 GGAGCGATAGATGAGCTTGAGGG - Intergenic
1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG + Intronic
1124452789 15:29811709-29811731 GAAACCATAAAACATCTTGCTGG + Intronic
1126445431 15:48738304-48738326 GGAACAATTAATTTTCTTGAAGG + Exonic
1127007933 15:54591705-54591727 GGAAAGATAAATAAAATTGATGG - Intronic
1133068126 16:3224968-3224990 GGAACCACTCATCATCTTGAAGG + Intronic
1145854476 17:28140109-28140131 GGAATGGTAAATCATCTAGTTGG + Intronic
1151058892 17:71067844-71067866 GGAAAGATAAAGAATCTTGTAGG - Intergenic
1151401255 17:73857481-73857503 GGAGGGATAAATCATGTTGTGGG - Intergenic
1151900428 17:77008902-77008924 GGAAAGATAAATCCTCAGGATGG + Intergenic
1155098304 18:22581518-22581540 GGAAAGATATATGATGTTGATGG - Intergenic
1159410150 18:68062593-68062615 GGAACCATATATCATGTTCATGG + Intergenic
1160618144 18:80149428-80149450 GTAACAATAAATCATTTTGGAGG - Intronic
1163056297 19:14721403-14721425 GGGACGATAAAATATTTTGATGG - Exonic
926356258 2:12043419-12043441 GGAAAGATGATGCATCTTGATGG + Intergenic
928487305 2:31745709-31745731 GGAAGGACACATCATTTTGAGGG - Intergenic
929841505 2:45469627-45469649 GGAAGCATAATTCATCCTGAAGG + Intronic
932859603 2:75275996-75276018 GCAACGATAAATCAGCTGAATGG - Intergenic
935541650 2:104355172-104355194 GAAACAATAAAACATCTAGAAGG + Intergenic
936952476 2:117992111-117992133 GGAATGATAAAGAATCTTCATGG - Intronic
937691775 2:124763938-124763960 AAAACGATAAACCATGTTGAAGG + Intronic
941745384 2:169081345-169081367 GGAACGATTTATCATTTAGATGG + Intronic
941836759 2:170030724-170030746 TGAACTATAAATCAAGTTGATGG - Intronic
942132661 2:172896169-172896191 GGAAGGTTAATACATCTTGATGG - Intronic
945402910 2:209408824-209408846 GTAATTATAAATCATGTTGATGG + Intergenic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1177024139 21:15901002-15901024 GGAAAGATACTTCATGTTGATGG + Intergenic
1184203594 22:42986084-42986106 GGAAAGGGAAATCACCTTGAGGG - Intronic
958408210 3:93775692-93775714 GGAACAATAAATCCACTTGCAGG + Intergenic
962434953 3:135357644-135357666 GGCAAGATAATTCATCTTAAGGG - Intergenic
966464967 3:180221076-180221098 GGAAAGATAACTCATTTTTATGG - Intergenic
966701309 3:182854936-182854958 GGAACAATATATCATGTTCATGG + Intronic
968029379 3:195470005-195470027 TGTACTTTAAATCATCTTGAGGG + Intergenic
972002071 4:34050022-34050044 GGAAAGACAAATCCTCTTAATGG + Intergenic
981880674 4:149607430-149607452 GCAACAAGAAATCATCTTGAAGG + Intergenic
985816176 5:2129967-2129989 GGAACGATCAAAAATATTGATGG - Intergenic
988288192 5:29249626-29249648 GGCACAATCAATCATTTTGAAGG - Intergenic
991367239 5:65882110-65882132 GGAGAGATAAACCATCTTCATGG + Intergenic
991692999 5:69243758-69243780 GGAAAGATAATTCATATTCATGG - Intronic
995157188 5:108930054-108930076 GTATCCATAAATTATCTTGAGGG - Intronic
999506034 5:152197406-152197428 GGAGAGATCAATCTTCTTGAGGG + Intergenic
1002736314 5:181389555-181389577 GGAAAGATATATCATGTTCATGG + Intergenic
1004612952 6:17263541-17263563 GGAAATATTAATCGTCTTGATGG + Intergenic
1010084729 6:71903967-71903989 GGAAGGATAATTTATCTTGTTGG - Intronic
1012726587 6:102820207-102820229 GAAAGGATAATTTATCTTGAAGG + Intergenic
1015301878 6:131662006-131662028 GAAACTATAAATCTTCTAGAAGG - Intronic
1022494847 7:30846383-30846405 GGGAAAATAAATGATCTTGAGGG - Intronic
1030228695 7:107181673-107181695 GGGAAGAAAAAGCATCTTGAAGG - Intronic
1031198036 7:118641447-118641469 TGAATGATACATCATCGTGATGG - Intergenic
1033503461 7:141976921-141976943 GGAATGAGCTATCATCTTGAGGG - Intronic
1035084140 7:156242038-156242060 GGAAAGATATTTCATCTTCATGG - Intergenic
1035506705 8:143012-143034 GGAAAGATATATCATGTTCATGG - Intergenic
1038965173 8:32564063-32564085 TGTATGATAAATCATTTTGATGG + Intronic
1040750540 8:50700695-50700717 GGAACGATAAATCATCTTGAGGG - Intronic
1043167628 8:76924142-76924164 GGAACAAAAAATCCTCATGATGG - Intergenic
1043255928 8:78136638-78136660 GCATGGATACATCATCTTGAAGG - Intergenic
1051965414 9:22822902-22822924 GGAGGAATAAATCATCTTCATGG - Intergenic
1053368501 9:37541318-37541340 GCAAGGTGAAATCATCTTGAAGG - Exonic
1055178858 9:73357765-73357787 GGAAAGATAAATAATATTGGGGG - Intergenic
1056087953 9:83172860-83172882 GCAACAATAAATCATCTTAAGGG - Intergenic
1059926731 9:119217205-119217227 GGAACCATAAATAATTTGGAGGG + Intronic
1060772683 9:126344309-126344331 TGAAAGATAAATCATCTATAAGG - Intronic
1188249047 X:27869250-27869272 GGAACAAGAGATCATTTTGAGGG - Intergenic
1188910494 X:35841158-35841180 GGGGCGATAAATCATTGTGAGGG - Intergenic
1194473462 X:94328002-94328024 GAAATGATAAATCATCTTGTGGG - Intergenic
1196552810 X:117049904-117049926 GGAAAGATAATTCATGTTCATGG + Intergenic
1196639681 X:118044245-118044267 GGAAAGATATTTCATCTTCATGG + Intronic
1197277815 X:124500296-124500318 GGAAAAATAGATCATTTTGAAGG + Intronic
1197377233 X:125696098-125696120 GGACCAAAAAATCATCTTGTAGG + Intergenic
1197511646 X:127376432-127376454 GAAACGATGAATCAAATTGATGG + Intergenic
1198384024 X:136110687-136110709 GGAGAGATATATCATGTTGATGG - Intergenic
1201553516 Y:15243932-15243954 GGAACAATAAATCATGTTGCAGG + Intergenic
1202329155 Y:23728135-23728157 GAAAGGATCAATCATATTGATGG - Intergenic
1202541616 Y:25941919-25941941 GAAAGGATCAATCATATTGATGG + Intergenic