ID: 1040756695

View in Genome Browser
Species Human (GRCh38)
Location 8:50783832-50783854
Sequence CTGAAGTTCTGGAGCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040756695_1040756699 23 Left 1040756695 8:50783832-50783854 CCATCTTGGCTCCAGAACTTCAG 0: 1
1: 0
2: 1
3: 27
4: 263
Right 1040756699 8:50783878-50783900 TATGATGAGTGATCTTCTATTGG No data
1040756695_1040756698 0 Left 1040756695 8:50783832-50783854 CCATCTTGGCTCCAGAACTTCAG 0: 1
1: 0
2: 1
3: 27
4: 263
Right 1040756698 8:50783855-50783877 TTTGAGTTTTCACTGGTTCTTGG No data
1040756695_1040756697 -7 Left 1040756695 8:50783832-50783854 CCATCTTGGCTCCAGAACTTCAG 0: 1
1: 0
2: 1
3: 27
4: 263
Right 1040756697 8:50783848-50783870 ACTTCAGTTTGAGTTTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040756695 Original CRISPR CTGAAGTTCTGGAGCCAAGA TGG (reversed) Intronic
900294874 1:1943795-1943817 CTGGAGGTCAGAAGCCAAGACGG + Intronic
900437448 1:2638143-2638165 CTGAGGTTCTAGAGGCAACAGGG - Intronic
901083678 1:6597806-6597828 CTGAAGCTCTGGGTCCAGGAGGG - Intronic
901489897 1:9591337-9591359 CTGAAGTTCTGGTGCGAGGCAGG - Intronic
901511088 1:9718394-9718416 CTGAAGTTCTTGATCCCTGATGG + Intronic
901531183 1:9853475-9853497 CTGCAGTTTTAGAGCCAGGAGGG + Intronic
902194781 1:14790318-14790340 CTGAATTTCTTGACCCAGGATGG + Intronic
902328132 1:15716162-15716184 CAAAAGTTCTGGAATCAAGAAGG - Intronic
903274238 1:22210664-22210686 CTGAAGCTGTGATGCCAAGAAGG + Intergenic
903282678 1:22258953-22258975 CGGAAGGTCTGGAGTCTAGAAGG - Intergenic
903438148 1:23368127-23368149 CTGGAGTTCTGGCCCCAAGGCGG + Intronic
903473820 1:23605907-23605929 ATGATGTGCTGGAGCCGAGAGGG - Intronic
903546376 1:24126144-24126166 CTGACGTTCTGGGGCTAAGCTGG - Intronic
903680689 1:25094665-25094687 CTGAGGTTCTGGTACTAAGAAGG + Intergenic
904538645 1:31217875-31217897 CTGGAATCCAGGAGCCAAGAGGG - Intronic
904957902 1:34302804-34302826 CTGAAATTATGGAGACCAGAAGG - Intergenic
905902285 1:41589489-41589511 CTGAAGCTCTGGAACCAAACTGG + Intronic
906281710 1:44559168-44559190 AGGAAGTTCTGGAGGCAAGGTGG - Intronic
910851609 1:91654769-91654791 CTGAAGTTCTGAAGACACAAGGG - Intergenic
914943139 1:152040182-152040204 CTGAAGGGCTGGAGCCAGCAAGG + Intronic
915285630 1:154850291-154850313 CTGAAGTCCTGCAACCAACAAGG + Intronic
915561498 1:156690788-156690810 ACCAAGTTCTGGAGCCAGGACGG - Intergenic
915684243 1:157615606-157615628 CTGAACTTCTGGAACCCTGAAGG + Intergenic
916400802 1:164446696-164446718 CTGAAGTTTTAGAGCTAAGTTGG - Intergenic
916633038 1:166637714-166637736 ATGGTATTCTGGAGCCAAGATGG + Intergenic
917240639 1:172944804-172944826 TTGCAGTTCAGGTGCCAAGAGGG - Intergenic
917831579 1:178895580-178895602 CTAGAGTTCAGGAGACAAGAAGG + Intronic
918045626 1:180939305-180939327 CTGAAGTTCTGGAGAGCAGATGG - Intronic
918331868 1:183469158-183469180 CTGAAGTTCAGACACCAAGATGG + Intergenic
919470509 1:197973303-197973325 CTTAGGTTTAGGAGCCAAGAGGG - Intergenic
922010871 1:221585358-221585380 CTCAATTACTGGAGCAAAGATGG + Intergenic
922535834 1:226379974-226379996 TTGAAGTTGTGGCCCCAAGAGGG - Exonic
924071349 1:240283443-240283465 GTGCATTTCTGGAGCCAATAAGG + Intronic
924430791 1:243994795-243994817 CCGAAGGTCTGGAGCTAAGAGGG - Intergenic
1063880017 10:10521635-10521657 CTGAAGTGGTAGAGCCAAAATGG + Intergenic
1064476058 10:15690288-15690310 TTCAGGTTCTGGAGCCAACAGGG - Intronic
1064561830 10:16601221-16601243 CTGAAGTTCTGGAGACATGGAGG - Intronic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1066152929 10:32642787-32642809 ATGAGGTGCTGGAGCCAAGATGG - Intronic
1067211150 10:44261179-44261201 CTCAAGGTTTGGTGCCAAGATGG - Intergenic
1067689436 10:48491990-48492012 CTTAAGTTCAGGAGCTCAGAGGG - Intronic
1068926468 10:62544701-62544723 CTTAACTGCTAGAGCCAAGATGG + Intronic
1070702238 10:78612610-78612632 CTGAGAGTGTGGAGCCAAGAAGG - Intergenic
1070977366 10:80615634-80615656 TAGAATTTCTGGAGCTAAGAGGG + Intronic
1072026656 10:91466921-91466943 ATGGAGATTTGGAGCCAAGATGG + Intronic
1072422169 10:95298004-95298026 CTGAAGTTGTGAATCCCAGAGGG + Intergenic
1072852037 10:98906110-98906132 CTGAAGCTCTGGAGCTGGGATGG - Intronic
1073057460 10:100711508-100711530 CTTAAGCCCTGGAGCCCAGAGGG - Intergenic
1073138299 10:101231526-101231548 TGGAAGCTCTGGGGCCAAGAGGG + Intergenic
1074048719 10:109863339-109863361 CAGAAATTCTGGAGGCCAGAAGG + Intergenic
1074342799 10:112651133-112651155 CTGACTTTCTAGGGCCAAGAAGG - Intronic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1075798684 10:125138753-125138775 CTGTAGTTCTGGAGCCTGAAAGG - Intronic
1076261851 10:129072781-129072803 CTGAAGCTGTGAAGACAAGAAGG + Intergenic
1077718282 11:4602407-4602429 CTGTATCTGTGGAGCCAAGATGG + Exonic
1080187477 11:29507187-29507209 CTGAAATTCTGGAACTAAGGAGG - Intergenic
1080196186 11:29612219-29612241 CTGAAATTCTGAAGCTCAGAAGG + Intergenic
1081804472 11:45882966-45882988 GTGCACTCCTGGAGCCAAGAGGG + Exonic
1082218813 11:49607373-49607395 CTAAATTTCAGGAGCCAACATGG + Intergenic
1083616291 11:64028246-64028268 CTGAGGGTCTGGAGCCGAGGGGG + Intronic
1084183292 11:67457184-67457206 ATGAAGTACTGGAGCCCAGTGGG - Intronic
1084331240 11:68431887-68431909 CTGGAGTTCCCGAGCCAGGAGGG - Intronic
1085171004 11:74449866-74449888 GGGGAATTCTGGAGCCAAGATGG + Intergenic
1086416480 11:86593473-86593495 CTGAAGTTCTGGAGCCTTTGTGG - Intronic
1086630757 11:89016749-89016771 CTAAATTTCAGGAGCCAACATGG - Intronic
1088699322 11:112397939-112397961 CTGAAGTCCTAGAGCCTGGATGG - Intergenic
1088840833 11:113626411-113626433 CTCTAGTTCTGGAGGCTAGAAGG + Intergenic
1089507683 11:118974996-118975018 CTGGAGTTCTGGAGAGAAGTGGG + Intronic
1089647478 11:119889706-119889728 CTGAGGCTCTGGAGCCTGGAAGG - Intergenic
1090249724 11:125242730-125242752 CTAAAACTCAGGAGCCAAGAAGG - Intronic
1091580272 12:1783047-1783069 CTTGAGGTCAGGAGCCAAGATGG - Intronic
1091951417 12:4596177-4596199 ATGAAGTTCTGGAGACAATCGGG + Exonic
1093041283 12:14382536-14382558 CTGCAGTTCAGAATCCAAGATGG - Intronic
1095701837 12:45198654-45198676 CTGAAGAGCTGGGACCAAGAGGG - Intergenic
1095970202 12:47896599-47896621 CCGAAGGTTTGGAGCCTAGAAGG - Intronic
1097407487 12:59208609-59208631 TGGAAGTTCTAGAGTCAAGATGG - Intergenic
1098296238 12:69006838-69006860 CTGAATTTCAGGAACCAACAAGG - Intergenic
1098506088 12:71252123-71252145 CAGAAGTTATGGAGCTAAAAAGG + Intronic
1098590141 12:72201499-72201521 CAGAGGGTCTGGAGCCTAGAGGG - Intronic
1098634811 12:72769563-72769585 ATGAATCTTTGGAGCCAAGAGGG - Intergenic
1104332149 12:127856916-127856938 CAGAAAGTCTGGAGTCAAGAGGG + Intergenic
1105735656 13:23267484-23267506 TTGAAGTTCTGGATCCAAGACGG - Intronic
1106284076 13:28303763-28303785 TTGCAGTTCTGGAGGCCAGAAGG - Intronic
1106949900 13:34871806-34871828 CTGTAAGTCTGGAGCCAAGGGGG - Intergenic
1108423676 13:50276583-50276605 CTGAAATTCTTGAGCCAGGTAGG - Intronic
1109811222 13:67515235-67515257 CTGAATTTCTGGAGCAGAGTGGG - Intergenic
1112007445 13:95266430-95266452 CTTAAGTTCAGGAGGCCAGAAGG - Intronic
1112579042 13:100662845-100662867 CTCCAGCTCTGGAACCAAGATGG + Intronic
1114602675 14:23969367-23969389 CTCAAGTTCTGGAGACAGGGAGG - Intergenic
1114607043 14:24006496-24006518 CTCAAGTTCTGGAGACAGGGAGG - Intergenic
1115131929 14:30064275-30064297 TTGAGGTTCTGGAACCAAAATGG + Intronic
1115497274 14:34018600-34018622 GTGATGTGCTGAAGCCAAGAAGG - Intronic
1116421581 14:44738859-44738881 CTCAGGTTCTGGAGTCAAGTTGG + Intergenic
1116688618 14:48075881-48075903 GGGAAGTTCTGGAGCCCAGGAGG + Intergenic
1117104496 14:52384282-52384304 ATCAAATTCAGGAGCCAAGATGG + Intergenic
1119223225 14:72925920-72925942 CAGCAGTACTGGAGCCAACACGG + Intergenic
1120859237 14:89239895-89239917 CATGAATTCTGGAGCCAAGAGGG + Intronic
1120872569 14:89351209-89351231 CTAAATTTCTGGAGCAGAGATGG - Intronic
1121403482 14:93703289-93703311 TGGAAGTTCTGGAGACCAGAAGG + Intronic
1122375198 14:101252634-101252656 CTGAAGTTCCGCAGCCAAGCAGG + Intergenic
1122553050 14:102560492-102560514 CTGAAGTTTTGGAGCTAGGTTGG + Intergenic
1123711491 15:22990985-22991007 TTGAAGTTCTGGAGGACAGAAGG - Intronic
1123945881 15:25238692-25238714 CTGGAGTTCTTGCCCCAAGAGGG + Intergenic
1127435086 15:58949433-58949455 CTGAAATACTGAAGCGAAGAAGG + Intronic
1128236857 15:66073487-66073509 CTGAAGCACTGCAGCTAAGATGG - Intronic
1128543396 15:68552019-68552041 CTGAGGTTCTGGAACCCAGAAGG + Intergenic
1129505133 15:76075132-76075154 CTGAAGTTCTGGGGAGAAGATGG + Intronic
1129779050 15:78257331-78257353 CTGAGGACTTGGAGCCAAGAAGG + Intergenic
1131033819 15:89207894-89207916 ATGAACATCTGGAGCTAAGAAGG - Intergenic
1131957847 15:97756834-97756856 GAGAAGATCTGAAGCCAAGATGG - Intergenic
1133025786 16:2988426-2988448 CTGGGGTTCTGGAGACAAGGAGG + Intergenic
1133229663 16:4360541-4360563 CTGAAGATCTGGGGGCAGGAAGG + Exonic
1133430410 16:5732291-5732313 TTAAAGACCTGGAGCCAAGAGGG + Intergenic
1133751493 16:8729569-8729591 CAGCACTTCAGGAGCCAAGATGG + Intronic
1134045010 16:11094456-11094478 CTGAGCAGCTGGAGCCAAGAGGG - Intronic
1134612380 16:15619515-15619537 CTGAAGTGCTGGAGGAAGGAGGG - Intronic
1136271878 16:29153455-29153477 CTCTAGTTCTGGAGACCAGAAGG + Intergenic
1137552352 16:49447107-49447129 CTGTAGTACTGGAGTAAAGACGG - Intergenic
1137779897 16:51089157-51089179 CAAAAGTTGGGGAGCCAAGAAGG - Intergenic
1137849972 16:51731865-51731887 CTGAATTTCTGGAGCGGACAGGG + Intergenic
1138144898 16:54599548-54599570 CTAAAGTTATAAAGCCAAGAAGG - Intergenic
1138706732 16:58922502-58922524 ATGATGTCCTGGAGCCCAGAGGG - Intergenic
1139186170 16:64808612-64808634 CTTAAGTTCTTGAGCCAAACAGG - Intergenic
1140280865 16:73554449-73554471 CTGAAGTGCTGAAGGCAAGATGG - Intergenic
1141845461 16:86605431-86605453 CAGAATTTCTGTAGCCAAGTAGG + Intergenic
1142075543 16:88115611-88115633 CTCTAGTTCTGGAGACCAGAAGG + Intronic
1142186564 16:88697626-88697648 CTGTAGTCCTGGAGACAGGAAGG + Exonic
1144582993 17:16470515-16470537 GTGATGTTCTAGAGCCAGGAGGG - Intronic
1146484171 17:33229981-33230003 CTGGGATTCTGGAGCCCAGATGG + Intronic
1146561845 17:33877132-33877154 ATGAGGTGGTGGAGCCAAGATGG + Intronic
1147165582 17:38591452-38591474 CTGAAGGCCAGCAGCCAAGAGGG - Intronic
1147450311 17:40500225-40500247 CTGGGATTCTGGAACCAAGAGGG + Intronic
1147865211 17:43547274-43547296 CTGATGATCTGGAGGCAGGATGG + Intronic
1148194198 17:45701552-45701574 CGGGAGTTCTGGAGCTAGGATGG - Intergenic
1148673775 17:49433022-49433044 CTGGAGAGCTGGAGCCATGAAGG - Intronic
1151469462 17:74309160-74309182 CTGAGATCCTGGAGCCCAGAAGG + Intronic
1152531824 17:80923329-80923351 CTGGGGTTCGGGAGCCATGATGG + Intronic
1152763626 17:82122849-82122871 ATGAAGATGTGGAGTCAAGAGGG - Intronic
1156954597 18:42946929-42946951 AAGAAATTCTGGAACCAAGATGG - Intronic
1160933213 19:1580516-1580538 TGGAAGTGCTGGAGCGAAGACGG - Intronic
1162195281 19:8979932-8979954 CTGAAGTGCTGGTGCCACCAAGG + Exonic
1163115008 19:15183951-15183973 CTGAGGTGCTTGAGCCCAGAAGG + Intronic
1165319381 19:35076063-35076085 CTGAGGTCCGGGAGCCAGGAAGG - Intergenic
1165529178 19:36382415-36382437 CTGGAATTCTAGAGGCAAGAGGG + Intergenic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1166054806 19:40282082-40282104 TTGAAGTTCTGGATCCTAGCTGG + Intronic
927828831 2:26330519-26330541 CAGAATTTATGGTGCCAAGAGGG - Intronic
928256593 2:29728302-29728324 CCAAGGTTCTGGAGCCAAAAGGG + Intronic
929688571 2:44055870-44055892 CTGAGGTGTGGGAGCCAAGACGG - Intergenic
932321116 2:70822654-70822676 TTGAAGTAATGGAGACAAGAAGG - Intergenic
932831795 2:74997159-74997181 CTGAGCTTCTGGAGCCAGCATGG - Intergenic
933817903 2:86083161-86083183 CTCAATTCCTGGAGCCAAGGAGG + Exonic
935601173 2:104922954-104922976 CAGAAATTCTGGAGGCCAGAAGG + Intergenic
935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG + Intergenic
936949068 2:117958980-117959002 CTGATGTTCTGGAGTTAACAGGG + Intronic
937039049 2:118807092-118807114 CTCAAGGTCTGGAGCCCAGAGGG + Intergenic
937239246 2:120449735-120449757 CTGAAGTCCTTGATGCAAGAAGG + Intergenic
940378908 2:152990752-152990774 CTGTACTTCTGTAGCTAAGATGG + Intergenic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
941274605 2:163475141-163475163 CTGCAGTTCTGGGGCAAAGCTGG - Intergenic
941576192 2:167233507-167233529 CTGAAGTTCTAGGGTAAAGAGGG + Intronic
942047380 2:172107775-172107797 CTCAAGCTCGGGAGCCAGGAGGG - Intergenic
942499301 2:176571677-176571699 TTGAAGTTCAGCAGCCAAGAGGG - Intergenic
943479432 2:188399468-188399490 TTAAAGTTCTGGAACCAAGACGG + Intronic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
944313878 2:198264819-198264841 CTGGAGTTCTGATGCTAAGAAGG + Intronic
945288513 2:208106130-208106152 CTGAAGTTTAGGGGCCCAGAGGG - Intergenic
946147667 2:217743198-217743220 GTGTAATTCTGAAGCCAAGAGGG + Intronic
947081104 2:226398093-226398115 CTGAAGTTCTAGAGTCCAGCCGG + Intergenic
947220618 2:227788356-227788378 CTGAAGACCTGGATCTAAGAAGG + Intergenic
947545061 2:231004686-231004708 CTGGAGTTCTGGAGGCAGGCAGG + Intronic
1170218281 20:13915343-13915365 CTGAAATTCTGGAGGCGGGAAGG + Intronic
1171075047 20:22114627-22114649 GAAAAGTCCTGGAGCCAAGATGG + Intergenic
1172829729 20:37823428-37823450 CTGAAGCCCTGGAGCCTGGAGGG + Intronic
1173642478 20:44613707-44613729 GTGAAGTTCAGGTGCCAAGATGG - Intronic
1176038635 20:63052594-63052616 CTGGAGTCCTGGAGCTCAGAGGG + Intergenic
1177547197 21:22574407-22574429 TCAAACTTCTGGAGCCAAGAGGG - Intergenic
1178779527 21:35588262-35588284 CTGCAGTTCTGGAGCAGCGAAGG - Intronic
1181669668 22:24420284-24420306 CTGAGGATCTGGAGCCTGGATGG + Intronic
1181689062 22:24548246-24548268 CTGCAACTCTGGAGCCAGGACGG - Intronic
1182630309 22:31680137-31680159 TTGCAGTTCTGAGGCCAAGAAGG + Intronic
1183830204 22:40414764-40414786 ATGAAGTTCTGGAGCGGATAGGG + Intronic
1183885455 22:40877560-40877582 CTGAGATTCTGCAGCCAAGAAGG - Intronic
950174517 3:10863529-10863551 TTGATTTTCTGAAGCCAAGATGG + Intronic
950448248 3:13050580-13050602 CATGAGTTCTAGAGCCAAGAGGG + Intronic
953458780 3:43064766-43064788 CTGATTTTCAGGAGCCAAGATGG + Intergenic
953795982 3:45986370-45986392 CTGGACTCCTGGAGCCACGAGGG - Intronic
954691680 3:52399058-52399080 CTGCAGGCCTGGATCCAAGATGG + Exonic
957034306 3:75279458-75279480 CACAAATTTTGGAGCCAAGATGG - Intergenic
958671649 3:97213317-97213339 CTGAAGCTGTGGTTCCAAGAGGG - Intronic
959018989 3:101168028-101168050 CTGAAAATGTGTAGCCAAGAAGG - Intergenic
959650846 3:108749390-108749412 ATGAGGATCTCGAGCCAAGATGG + Intronic
962843276 3:139254195-139254217 ATGAAGTTCTGGAGCTCACAGGG - Intronic
963470827 3:145739832-145739854 CTGAAATTCTGAAGGGAAGAAGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967967756 3:194975404-194975426 CTGAAGGTCTGAAGCCTTGAGGG - Intergenic
968542430 4:1174801-1174823 ATGAAGTGCTGGAGCCGATATGG - Intronic
969190621 4:5515735-5515757 TTTAAGTTTTGGAGTCAAGAGGG + Intergenic
969875703 4:10134194-10134216 CTGGAGTTCTGAAGCTAAGCGGG + Intergenic
970138335 4:12951121-12951143 TTGAAGTTCTGGAGGCCAGAAGG + Intergenic
971251546 4:24976822-24976844 CTCCAGCTCTGGAGCCAAGCGGG + Intronic
972870690 4:43293883-43293905 CTGGAGTTCTGGAGCTGAAATGG + Intergenic
973890938 4:55366708-55366730 CTGAGGCTCTGGAGCCAAGGGGG - Intronic
975342065 4:73253852-73253874 CAGAAGCCCTGGATCCAAGAAGG + Intronic
975380112 4:73690197-73690219 GGGGAGATCTGGAGCCAAGAGGG + Intergenic
975421353 4:74167700-74167722 CTGAAGATCTGGAGAGAACATGG + Intronic
976077090 4:81312144-81312166 CTGAGGATTTGGAGGCAAGAAGG + Intergenic
978977140 4:114891659-114891681 ATGAAGTTCTAGAACAAAGATGG - Intronic
979032434 4:115666439-115666461 CCAAAGTTCGGGAGCCTAGAAGG - Intergenic
979606443 4:122643660-122643682 CTGAAGTTGAGGAGCCCTGAAGG + Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
984363547 4:178769548-178769570 CTGAATTTATGGAGACCAGAAGG - Intergenic
984398007 4:179225512-179225534 CTCAAGTTCAGGAAACAAGAGGG + Intergenic
986909003 5:12531877-12531899 TTAAATGTCTGGAGCCAAGATGG + Intergenic
987080206 5:14419172-14419194 CTGAAGTGGGGGAGCCTAGAAGG + Intronic
989183541 5:38601426-38601448 TTGAAGGACTGGAGCAAAGATGG + Intronic
989393971 5:40933000-40933022 GTGAAGTTCCAGAGCCCAGATGG - Intronic
990597235 5:57323924-57323946 CTGGAGTTCTGGAGGTTAGAAGG - Intergenic
991016761 5:61941218-61941240 TTGAGGTTCAGTAGCCAAGAGGG - Intergenic
994535765 5:101027252-101027274 CTGGAGCTCTGGGGCCAGGATGG + Intergenic
997630126 5:135361041-135361063 CTGACCTTCTGGAGTCAGGAAGG - Intronic
998029951 5:138857775-138857797 CTCAAATTCTGGAGCCAGGCTGG - Intronic
1001189879 5:169620049-169620071 CTGGTGTGCTGGAGCCAAGATGG + Intergenic
1002685763 5:181008198-181008220 CTGAAGCTAGGGAGCCAAGTGGG + Intergenic
1002837450 6:876895-876917 CTGAAGTTCTGCAGAGCAGACGG + Intergenic
1005471938 6:26169834-26169856 CTGTAGTCCTTGAGCCAAGAGGG + Intronic
1005680881 6:28207276-28207298 CTTAAGATCTGGAGCCCAGCAGG - Intergenic
1006569310 6:34987519-34987541 CTGCACTTCTGGAGCAAAGAAGG + Intronic
1006596046 6:35193054-35193076 CTGGAGTCTTGGAGCAAAGAAGG - Intergenic
1007046114 6:38775875-38775897 ATGACATTCTGGATCCAAGAAGG + Exonic
1007365236 6:41386928-41386950 CAGATGCTCTGGAGCCAACATGG - Intergenic
1008514045 6:52302871-52302893 GAGAAGTTCTGGACCAAAGATGG - Intergenic
1008566871 6:52777355-52777377 ATGAAGGGGTGGAGCCAAGATGG - Intergenic
1011318072 6:86057942-86057964 CGGGAGGGCTGGAGCCAAGATGG - Intergenic
1011429915 6:87274554-87274576 ATAAACTTCTGGAGCCAGGAAGG + Intergenic
1011998736 6:93626436-93626458 CTGAAGTCTGGGAGCCAACATGG + Intergenic
1014237964 6:118981934-118981956 TTAAAGTTTTGGAGCCAAGGTGG + Intronic
1015191308 6:130475509-130475531 CAGAATTGGTGGAGCCAAGATGG + Intergenic
1016276925 6:142364759-142364781 CAGTACTTCTGGAGCCAAGGTGG + Intronic
1017322352 6:153108513-153108535 CTGAAGTTCTGGGCACAAGGGGG - Intronic
1017380290 6:153820639-153820661 CTCAGGTTTTGGAACCAAGATGG - Intergenic
1019289869 7:245212-245234 CTGGAGTGTTGGAGCCCAGACGG + Intronic
1021656799 7:22881127-22881149 CTGAAGTGCTGAAGCACAGAGGG - Intergenic
1023713271 7:43017186-43017208 CAGAAGATCAAGAGCCAAGAAGG + Intergenic
1025600584 7:62992742-62992764 CTCAAGCTCTGAAGCCAAGGAGG + Intergenic
1025869150 7:65414783-65414805 CTGAAGGGGTGGAGCCAAGATGG + Intergenic
1027400053 7:77798113-77798135 CAGAAGCCCTGGAGCCAAGCAGG + Intronic
1028211219 7:88077355-88077377 ATGAGGGTCGGGAGCCAAGATGG + Intronic
1034286360 7:149885579-149885601 CTGAGGTTAGGGAGCCAAGGCGG - Intergenic
1040756695 8:50783832-50783854 CTGAAGTTCTGGAGCCAAGATGG - Intronic
1043534016 8:81180675-81180697 CTGAAGTTTTGCTTCCAAGATGG + Intergenic
1044878922 8:96702058-96702080 CTGAAGTTGTGCTGGCAAGATGG + Intronic
1047184049 8:122616006-122616028 CCCAACTTCTGGAGACAAGAGGG - Intergenic
1048846956 8:138611181-138611203 CTCCATTTCTGGAGGCAAGAGGG - Intronic
1048873143 8:138815306-138815328 CGGAAGTCCTGGAGCCTGGAAGG - Intronic
1049192624 8:141296974-141296996 CTCAAGTTCTGGAGGCTGGAAGG - Intronic
1050731768 9:8717067-8717089 CTGATGTCCTTGAGCCCAGAAGG + Intronic
1051133153 9:13885509-13885531 CTGAAATTTTGGAGACCAGAAGG + Intergenic
1051899107 9:22019372-22019394 CTAAAGTGCCTGAGCCAAGATGG + Intronic
1052634395 9:31082699-31082721 CATAATTTCTGGAGCAAAGAGGG - Intergenic
1053420546 9:37974830-37974852 CTGAAATTCTGCAGGCAAAAAGG + Exonic
1053559776 9:39179153-39179175 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1053823887 9:41999397-41999419 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1054137340 9:61439790-61439812 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1054606685 9:67187970-67187992 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1055064416 9:72104242-72104264 CTTAAATTCTTGATCCAAGATGG - Intergenic
1055394105 9:75855124-75855146 CTGCAATTCTGGAGAAAAGAGGG + Intergenic
1056710675 9:88990336-88990358 CTGATCCTCTGGAGGCAAGAGGG + Intergenic
1056856562 9:90134814-90134836 CTGAAGTACTGGAGCCCCGGTGG - Intergenic
1057988991 9:99747777-99747799 CTGAAGTTCTAGTGCCAGGATGG - Intergenic
1058209895 9:102153752-102153774 TGGGAGTACTGGAGCCAAGATGG - Intergenic
1061901373 9:133673915-133673937 CTGAGCTGCTGGAGCCAGGAAGG - Intronic
1062034141 9:134375358-134375380 CTGCAATTCTGGAGGCAGGAAGG - Intronic
1062304440 9:135895392-135895414 CTGAAGCTATGGAGGCCAGAGGG + Intronic
1062563846 9:137154929-137154951 CTGAAGGTCTGGGGTCAAGAAGG - Intronic
1185977585 X:4738830-4738852 CTGAATTGCTGGAGCAAAGGAGG + Intergenic
1186368921 X:8926641-8926663 CTGAAGTACTGTTGCCAAGCAGG + Intergenic
1186561087 X:10614324-10614346 CTGAACTTCTGGACCCACTAGGG - Intronic
1188940900 X:36235753-36235775 TCGATGTGCTGGAGCCAAGATGG - Intronic
1189131368 X:38501313-38501335 AGGAAGTTCTAGAGCAAAGACGG - Intronic
1190533659 X:51406379-51406401 CTGAACATCCGGAGGCAAGACGG + Intergenic
1191923385 X:66281063-66281085 CTGAAGTTCTAGAGGCTAGAGGG + Intergenic
1192346592 X:70313851-70313873 TTGAAGCTCTGAAGCTAAGATGG - Intronic
1192716240 X:73645103-73645125 CTCAGCTTCCGGAGCCAAGATGG - Intronic
1192928742 X:75782868-75782890 CTTAAGCTCTGGAGCCCAGCTGG + Intergenic
1193029227 X:76879993-76880015 CTGAGAAACTGGAGCCAAGATGG + Intergenic
1193551240 X:82895487-82895509 GTAAAATTGTGGAGCCAAGATGG + Intergenic
1193844934 X:86456273-86456295 CAGAAGGCCTGGGGCCAAGATGG - Intronic
1193884576 X:86969621-86969643 CTGGAGTTCGCGAGCCAAGATGG + Intergenic
1196458243 X:115904804-115904826 GTGAAGTTCTGGAGACAAAAAGG - Intergenic
1197747918 X:129945323-129945345 CTCAAGTTCTGAAGTCCAGAGGG - Intergenic
1201572119 Y:15425770-15425792 CTGAACTCCTGGGGCCAAGTAGG - Intergenic