ID: 1040761357

View in Genome Browser
Species Human (GRCh38)
Location 8:50849327-50849349
Sequence GACTGAGGAGCAGTAGTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040761357_1040761362 20 Left 1040761357 8:50849327-50849349 CCCGGCACTACTGCTCCTCAGTC No data
Right 1040761362 8:50849370-50849392 TCTTTGAGTATAAGCTGCCCTGG No data
1040761357_1040761363 30 Left 1040761357 8:50849327-50849349 CCCGGCACTACTGCTCCTCAGTC No data
Right 1040761363 8:50849380-50849402 TAAGCTGCCCTGGCTTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040761357 Original CRISPR GACTGAGGAGCAGTAGTGCC GGG (reversed) Intergenic
No off target data available for this crispr