ID: 1040761362

View in Genome Browser
Species Human (GRCh38)
Location 8:50849370-50849392
Sequence TCTTTGAGTATAAGCTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040761358_1040761362 19 Left 1040761358 8:50849328-50849350 CCGGCACTACTGCTCCTCAGTCT No data
Right 1040761362 8:50849370-50849392 TCTTTGAGTATAAGCTGCCCTGG No data
1040761359_1040761362 5 Left 1040761359 8:50849342-50849364 CCTCAGTCTTTAAAGAAGCCTTG No data
Right 1040761362 8:50849370-50849392 TCTTTGAGTATAAGCTGCCCTGG No data
1040761355_1040761362 22 Left 1040761355 8:50849325-50849347 CCCCCGGCACTACTGCTCCTCAG No data
Right 1040761362 8:50849370-50849392 TCTTTGAGTATAAGCTGCCCTGG No data
1040761357_1040761362 20 Left 1040761357 8:50849327-50849349 CCCGGCACTACTGCTCCTCAGTC No data
Right 1040761362 8:50849370-50849392 TCTTTGAGTATAAGCTGCCCTGG No data
1040761356_1040761362 21 Left 1040761356 8:50849326-50849348 CCCCGGCACTACTGCTCCTCAGT No data
Right 1040761362 8:50849370-50849392 TCTTTGAGTATAAGCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040761362 Original CRISPR TCTTTGAGTATAAGCTGCCC TGG Intergenic
No off target data available for this crispr