ID: 1040761363

View in Genome Browser
Species Human (GRCh38)
Location 8:50849380-50849402
Sequence TAAGCTGCCCTGGCTTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040761361_1040761363 -8 Left 1040761361 8:50849365-50849387 CCTTGTCTTTGAGTATAAGCTGC No data
Right 1040761363 8:50849380-50849402 TAAGCTGCCCTGGCTTAGCCAGG No data
1040761357_1040761363 30 Left 1040761357 8:50849327-50849349 CCCGGCACTACTGCTCCTCAGTC No data
Right 1040761363 8:50849380-50849402 TAAGCTGCCCTGGCTTAGCCAGG No data
1040761360_1040761363 -3 Left 1040761360 8:50849360-50849382 CCTTGCCTTGTCTTTGAGTATAA No data
Right 1040761363 8:50849380-50849402 TAAGCTGCCCTGGCTTAGCCAGG No data
1040761358_1040761363 29 Left 1040761358 8:50849328-50849350 CCGGCACTACTGCTCCTCAGTCT No data
Right 1040761363 8:50849380-50849402 TAAGCTGCCCTGGCTTAGCCAGG No data
1040761359_1040761363 15 Left 1040761359 8:50849342-50849364 CCTCAGTCTTTAAAGAAGCCTTG No data
Right 1040761363 8:50849380-50849402 TAAGCTGCCCTGGCTTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040761363 Original CRISPR TAAGCTGCCCTGGCTTAGCC AGG Intergenic
No off target data available for this crispr