ID: 1040768454

View in Genome Browser
Species Human (GRCh38)
Location 8:50944307-50944329
Sequence CGCCCAAAAGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040768448_1040768454 23 Left 1040768448 8:50944261-50944283 CCTGCTGGATCCGGAGGGGTGGA 0: 17
1: 53
2: 127
3: 140
4: 211
Right 1040768454 8:50944307-50944329 CGCCCAAAAGCAGTGGTGGACGG No data
1040768446_1040768454 24 Left 1040768446 8:50944260-50944282 CCCTGCTGGATCCGGAGGGGTGG 0: 17
1: 68
2: 120
3: 148
4: 241
Right 1040768454 8:50944307-50944329 CGCCCAAAAGCAGTGGTGGACGG No data
1040768449_1040768454 13 Left 1040768449 8:50944271-50944293 CCGGAGGGGTGGAAGTCAGCAGC No data
Right 1040768454 8:50944307-50944329 CGCCCAAAAGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040768454 Original CRISPR CGCCCAAAAGCAGTGGTGGA CGG Intergenic
No off target data available for this crispr