ID: 1040768724

View in Genome Browser
Species Human (GRCh38)
Location 8:50947860-50947882
Sequence GTTTTTAAGGGAATTTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040768724_1040768729 4 Left 1040768724 8:50947860-50947882 CCCTTTCAAATTCCCTTAAAAAC No data
Right 1040768729 8:50947887-50947909 ACATAATTTTATTTGATTATGGG No data
1040768724_1040768730 21 Left 1040768724 8:50947860-50947882 CCCTTTCAAATTCCCTTAAAAAC No data
Right 1040768730 8:50947904-50947926 TATGGGTATAGTGTTATATGAGG No data
1040768724_1040768728 3 Left 1040768724 8:50947860-50947882 CCCTTTCAAATTCCCTTAAAAAC No data
Right 1040768728 8:50947886-50947908 AACATAATTTTATTTGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040768724 Original CRISPR GTTTTTAAGGGAATTTGAAA GGG (reversed) Intergenic
No off target data available for this crispr