ID: 1040768952

View in Genome Browser
Species Human (GRCh38)
Location 8:50950123-50950145
Sequence CAGAACAGCCAGAAGTACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040768951_1040768952 13 Left 1040768951 8:50950087-50950109 CCGTGGTATATTCAGATAATCAA No data
Right 1040768952 8:50950123-50950145 CAGAACAGCCAGAAGTACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040768952 Original CRISPR CAGAACAGCCAGAAGTACTC TGG Intergenic
No off target data available for this crispr