ID: 1040774350

View in Genome Browser
Species Human (GRCh38)
Location 8:51021295-51021317
Sequence GTTCAGCATCACCATGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040774347_1040774350 5 Left 1040774347 8:51021267-51021289 CCAAAATAGACATCAAATCATTG No data
Right 1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG No data
1040774346_1040774350 16 Left 1040774346 8:51021256-51021278 CCGTAACTCAGCCAAAATAGACA No data
Right 1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040774350 Original CRISPR GTTCAGCATCACCATGCTAT AGG Intergenic
No off target data available for this crispr