ID: 1040779702

View in Genome Browser
Species Human (GRCh38)
Location 8:51093295-51093317
Sequence GCAGAAATTTAGGCCTGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040779702_1040779706 21 Left 1040779702 8:51093295-51093317 CCGCACCAGGCCTAAATTTCTGC No data
Right 1040779706 8:51093339-51093361 GTCTGAACCCTTGATTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040779702 Original CRISPR GCAGAAATTTAGGCCTGGTG CGG (reversed) Intergenic
No off target data available for this crispr