ID: 1040787072

View in Genome Browser
Species Human (GRCh38)
Location 8:51178618-51178640
Sequence CCCAGAGGGTACCCTGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040787065_1040787072 -9 Left 1040787065 8:51178604-51178626 CCAGCCCCACACCACCCAGAGGG No data
Right 1040787072 8:51178618-51178640 CCCAGAGGGTACCCTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040787072 Original CRISPR CCCAGAGGGTACCCTGAGTC TGG Intergenic
No off target data available for this crispr