ID: 1040787074

View in Genome Browser
Species Human (GRCh38)
Location 8:51178621-51178643
Sequence AGAGGGTACCCTGAGTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040787067_1040787074 -10 Left 1040787067 8:51178608-51178630 CCCCACACCACCCAGAGGGTACC No data
Right 1040787074 8:51178621-51178643 AGAGGGTACCCTGAGTCTGGTGG No data
1040787065_1040787074 -6 Left 1040787065 8:51178604-51178626 CCAGCCCCACACCACCCAGAGGG No data
Right 1040787074 8:51178621-51178643 AGAGGGTACCCTGAGTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040787074 Original CRISPR AGAGGGTACCCTGAGTCTGG TGG Intergenic
No off target data available for this crispr