ID: 1040787077

View in Genome Browser
Species Human (GRCh38)
Location 8:51178630-51178652
Sequence CCTGAGTCTGGTGGAGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040787069_1040787077 -3 Left 1040787069 8:51178610-51178632 CCACACCACCCAGAGGGTACCCT No data
Right 1040787077 8:51178630-51178652 CCTGAGTCTGGTGGAGACAAAGG No data
1040787070_1040787077 -8 Left 1040787070 8:51178615-51178637 CCACCCAGAGGGTACCCTGAGTC No data
Right 1040787077 8:51178630-51178652 CCTGAGTCTGGTGGAGACAAAGG No data
1040787067_1040787077 -1 Left 1040787067 8:51178608-51178630 CCCCACACCACCCAGAGGGTACC No data
Right 1040787077 8:51178630-51178652 CCTGAGTCTGGTGGAGACAAAGG No data
1040787068_1040787077 -2 Left 1040787068 8:51178609-51178631 CCCACACCACCCAGAGGGTACCC No data
Right 1040787077 8:51178630-51178652 CCTGAGTCTGGTGGAGACAAAGG No data
1040787065_1040787077 3 Left 1040787065 8:51178604-51178626 CCAGCCCCACACCACCCAGAGGG No data
Right 1040787077 8:51178630-51178652 CCTGAGTCTGGTGGAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040787077 Original CRISPR CCTGAGTCTGGTGGAGACAA AGG Intergenic
No off target data available for this crispr