ID: 1040798998

View in Genome Browser
Species Human (GRCh38)
Location 8:51320835-51320857
Sequence CAGATGTTAGAGGGGTTCCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040798998_1040799009 26 Left 1040798998 8:51320835-51320857 CCTTGGAACCCCTCTAACATCTG 0: 1
1: 0
2: 0
3: 17
4: 140
Right 1040799009 8:51320884-51320906 TCCAGCTTGTTTATCTGAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 185
1040798998_1040799008 25 Left 1040798998 8:51320835-51320857 CCTTGGAACCCCTCTAACATCTG 0: 1
1: 0
2: 0
3: 17
4: 140
Right 1040799008 8:51320883-51320905 CTCCAGCTTGTTTATCTGAAAGG 0: 1
1: 0
2: 1
3: 13
4: 160
1040798998_1040799012 30 Left 1040798998 8:51320835-51320857 CCTTGGAACCCCTCTAACATCTG 0: 1
1: 0
2: 0
3: 17
4: 140
Right 1040799012 8:51320888-51320910 GCTTGTTTATCTGAAAGGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 141
1040798998_1040799002 -3 Left 1040798998 8:51320835-51320857 CCTTGGAACCCCTCTAACATCTG 0: 1
1: 0
2: 0
3: 17
4: 140
Right 1040799002 8:51320855-51320877 CTGTACACCCTGCCTGCCTCAGG 0: 1
1: 0
2: 3
3: 19
4: 275
1040798998_1040799011 27 Left 1040798998 8:51320835-51320857 CCTTGGAACCCCTCTAACATCTG 0: 1
1: 0
2: 0
3: 17
4: 140
Right 1040799011 8:51320885-51320907 CCAGCTTGTTTATCTGAAAGGGG 0: 1
1: 0
2: 0
3: 17
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040798998 Original CRISPR CAGATGTTAGAGGGGTTCCA AGG (reversed) Exonic
900055840 1:629996-630018 CGGATGTCAGAGGGGTGCCTTGG - Intergenic
900086338 1:899555-899577 CAGGTGTCCGAGGGGTTTCAGGG + Intergenic
901327499 1:8376862-8376884 CAGGTGTTGGAGGGATCCCAGGG + Intronic
904572509 1:31477487-31477509 CAGATGGGAGAGTGGTTCCCAGG + Intergenic
906916549 1:50017310-50017332 CAGATATTAGAGAAGTTCCTTGG - Intronic
910589335 1:88912779-88912801 CAGATGTTAGTGAGGATGCAGGG - Intergenic
918294349 1:183142099-183142121 CAGCTCTTAGAGAGATTCCAGGG - Intronic
918446744 1:184624374-184624396 CAGATGCTAGAAGGATTCCAAGG - Exonic
921192161 1:212720110-212720132 CAGATGTTAGTGAGGTTTCATGG - Intergenic
923866185 1:237942114-237942136 CAGATATTAGAGAGGTTCCTTGG + Intergenic
924163659 1:241260124-241260146 CAGTGGTTAGAAGAGTTCCATGG - Intronic
1066083383 10:31954396-31954418 CAGAAGTTGGAGGGGTTCGGAGG + Intergenic
1066321986 10:34311910-34311932 CAGATGTTACAGGTGATTCAGGG - Intronic
1067220817 10:44343087-44343109 TACATGTTAGAGGTGTGCCAAGG - Intergenic
1069229932 10:65996452-65996474 GAGATGTCAGTGGGGTTCTAGGG + Intronic
1069488522 10:68841825-68841847 TAGATGTTGGAGGCGTTCCTGGG + Intronic
1074709746 10:116167356-116167378 CACGTGTTAGAGTTGTTCCAAGG - Intronic
1075182365 10:120223236-120223258 CAGATTTTAGATGTGTTCAATGG - Intergenic
1075261628 10:120968227-120968249 CAGCTCTTAGAGCAGTTCCATGG + Intergenic
1082792704 11:57358067-57358089 CAGATGTCTGAGAGCTTCCAAGG + Intronic
1086771235 11:90770155-90770177 GAAATGTTAGTGGAGTTCCAGGG - Intergenic
1087291254 11:96322952-96322974 CAGATTCTCCAGGGGTTCCAAGG - Intronic
1087439840 11:98169534-98169556 CAGATGTTAGTGAGGATGCAGGG + Intergenic
1087453446 11:98353485-98353507 CAGATGGCAGAGAGGTTCCTGGG - Intergenic
1089026490 11:115275666-115275688 GAGATTTTAGAGGGGTTGGAGGG + Intronic
1089684964 11:120140914-120140936 TAGATGTTACAGGGGTTGAATGG - Intronic
1093478663 12:19582664-19582686 CAGATGTTGGAAGAGTTCGAAGG + Intronic
1093860590 12:24161756-24161778 CAGTTGTTAGTGAGGGTCCAGGG + Intergenic
1093988827 12:25567982-25568004 CAGAGGTTAGAGGGGTTTGGAGG + Intronic
1096105741 12:48996311-48996333 CAGATGACAGAGGGGTTCTTGGG - Exonic
1096980639 12:55726682-55726704 CAGATGTGAGTGGGGTTGCTGGG - Exonic
1098063545 12:66587803-66587825 CAGAAGGCAGAGGGGTTCCAGGG + Intronic
1100671909 12:96822819-96822841 CAGATGTTAGAGAGCTGCTATGG - Intronic
1101452073 12:104788981-104789003 CAGAGGTTACAGGGGTTTCCTGG + Intergenic
1102802258 12:115746328-115746350 CAGTTGTTACAGAGGTTTCAAGG - Intergenic
1102957672 12:117069997-117070019 CAGATTGTAGTGGGGTGCCAGGG + Intronic
1104639058 12:130455804-130455826 CAGAGGTTAGACAGGTTTCATGG - Intronic
1108102387 13:46970459-46970481 GAAATGTCAGAGTGGTTCCAAGG + Intergenic
1108114141 13:47109379-47109401 CAGAAGTTAGAAGGGTTTGAAGG - Intergenic
1112738809 13:102451265-102451287 CAGATATTAGAGATGTTCCATGG + Intergenic
1118660128 14:67999851-67999873 TATGTGTTAGATGGGTTCCAAGG + Intronic
1120009592 14:79398673-79398695 CATCTGTTGGAGGGGTTCAAGGG + Intronic
1120162663 14:81162527-81162549 CAAATGTTAAAGGGGGACCAGGG - Intergenic
1122586238 14:102808549-102808571 CAGGTGCTAGAGGGCTTCCAAGG + Intronic
1124350892 15:28954843-28954865 CAGGTGTTAGAAAGGTTCCCAGG - Intronic
1125228607 15:37426099-37426121 CAGATGTTAGTGAGGATGCAGGG + Intergenic
1129295816 15:74599489-74599511 CAGAGTTCAGAGGGGTTCCGGGG + Intronic
1129652280 15:77499551-77499573 CAGCTGTTAGGGGGATTCCAGGG - Intergenic
1132953495 16:2578324-2578346 CAGATGGTACAGGGGCTGCAGGG + Intronic
1132960857 16:2621843-2621865 CAGATGGTACAGGGGCTGCAGGG - Intergenic
1133674119 16:8053814-8053836 CGGCTTTTAGGGGGGTTCCATGG - Intergenic
1133866364 16:9647742-9647764 AAGATGTTGGAGGGGTGTCAAGG - Intergenic
1139619064 16:68122495-68122517 GAGAAGTCAGAGGGGATCCAAGG - Exonic
1140220993 16:73043787-73043809 CAGATGTTGGAGGGCTTCTTTGG - Intronic
1142028744 16:87828149-87828171 CAGTAGATAGAGGGGTTCCCCGG + Intergenic
1144969027 17:19095542-19095564 CAGCTGCTAGAGGGGGTCTAAGG + Intronic
1144978889 17:19156524-19156546 CAGCTGCTAGAGGGGGTCTAAGG - Intronic
1144989333 17:19221708-19221730 CAGCTGCTAGAGGGGGTCTAAGG + Intronic
1145044682 17:19604066-19604088 CAGACATTAGAGAGGTTCCTTGG - Intergenic
1146126151 17:30233198-30233220 CTGATGTTTGCGGTGTTCCATGG - Intronic
1148920709 17:51030797-51030819 TTGATGCTAGAGGGCTTCCATGG + Intronic
1152689389 17:81711191-81711213 CTGGTGCTTGAGGGGTTCCAGGG + Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1159904452 18:74077453-74077475 CAGGTGTCTGAGGGGTTCCTGGG - Intronic
1168277427 19:55285357-55285379 CAGAGGCTGGAGGGGCTCCAGGG + Intronic
925458604 2:4041244-4041266 CAGCTGTAGGAGGCGTTCCAGGG + Intergenic
925627473 2:5855582-5855604 CAGATCTCAGAGGGGTTAGAAGG - Intergenic
926745618 2:16154616-16154638 CAGACATTAGATGGGTTTCAAGG - Intergenic
927278748 2:21284929-21284951 CAGATGTTAGAAGAGTTCAGCGG - Intergenic
930229894 2:48832761-48832783 CATATCTAAGAGAGGTTCCATGG - Intergenic
936861457 2:117025434-117025456 CAGATGTTAAAGAGATTCCTTGG - Intergenic
937302297 2:120850680-120850702 CAGAGGCTTGAGGGATTCCAGGG + Intronic
938151966 2:128894872-128894894 CAGATGTTAGGGGGTTTTCATGG - Intergenic
938308906 2:130272834-130272856 CAGATGTTAGAGAAGTTCCTTGG - Intergenic
938367382 2:130745352-130745374 CAGATGTTAGAAGTGTTCTGGGG - Intergenic
938446565 2:131385113-131385135 CAGATGTTAGAGAAGTTCCTTGG + Intergenic
938822809 2:134976127-134976149 AAGATGTAAGTAGGGTTCCAAGG + Intronic
947497240 2:230646780-230646802 CAGATGTTAGAGCAGACCCAAGG + Intergenic
948637511 2:239349033-239349055 CAAATGTGAGAGGGGGCCCATGG + Intronic
1168783275 20:513592-513614 CATATGTCAGATGGTTTCCAGGG - Intronic
1170794351 20:19533400-19533422 CAGATGTAAGAGGAGTTGCAAGG + Intronic
1172486188 20:35299041-35299063 CAGATGCTAGAGATGCTCCAGGG - Intergenic
1174384587 20:50179595-50179617 CAGACCCTAGAGGGGTTCCCAGG + Intergenic
1175233573 20:57492499-57492521 GAGATCTTAGAGGGGTTCTGAGG + Intergenic
1175244666 20:57574539-57574561 CCCATGTTAGAGGGGCCCCAGGG - Intergenic
1179935261 21:44599977-44599999 CAGATGGAAGAGGGGGTGCACGG + Intronic
1183029659 22:35094043-35094065 AAGATGTTACAGGGGAACCAAGG + Intergenic
1184303782 22:43580373-43580395 CAGAGGTGGGAGGGGTTTCAGGG + Intronic
950141604 3:10619853-10619875 CAGATGCTAGTGGGCTTCTATGG + Intronic
952543731 3:34396123-34396145 AGGATGTTAGTGGGGCTCCAGGG + Intergenic
956660920 3:71596570-71596592 AAGATGTGGGAGGAGTTCCAAGG + Intergenic
957133291 3:76250542-76250564 CACATGTCAGATGGGTTCCATGG - Intronic
957494191 3:80969523-80969545 GGGATGTTAGTGGGGCTCCAGGG + Intergenic
958958104 3:100483151-100483173 CATATTTTAGAGGGGTTCAAAGG - Intergenic
960623017 3:119654415-119654437 CAGATGTAAGAGGGGAAACATGG + Intronic
963066895 3:141271348-141271370 CAGATGTCAGTGGAGTTCCAAGG + Intronic
965662372 3:171055196-171055218 CAGATGTTAGAGGCTTCCCAGGG + Intergenic
968797989 4:2721763-2721785 CAGCTGTTTGTGGGGTTGCACGG - Intronic
969542125 4:7798924-7798946 CAGATCTGAGAAGGGTTGCAAGG - Intronic
972153184 4:36122118-36122140 CAGATGCTAGAGGGGTTATGGGG + Intronic
975811972 4:78178950-78178972 CAGATGTTCGAGGGGAGCGAAGG + Intronic
977903575 4:102450682-102450704 CAGATGCTAGTGAGGTTGCAGGG + Intergenic
979101901 4:116627704-116627726 CAGATGTTAGCGAGGCTGCAGGG - Intergenic
979261103 4:118646163-118646185 AATATGTCAGAGGAGTTCCACGG + Intergenic
981008173 4:139896974-139896996 CAGATTCTTGAGGTGTTCCATGG + Intronic
982194678 4:152899127-152899149 CAGATGTTGGAGGGGGTGGAGGG - Intronic
982537728 4:156627635-156627657 CAGATGTTAGAGGAAGTTCAGGG - Intergenic
984991814 4:185388120-185388142 CAGATGATGGAGGAGTTCCACGG + Intronic
986924392 5:12729531-12729553 CAGATGCTAGTGAGGTTGCAGGG + Intergenic
990275061 5:54186796-54186818 AAGATATTAGAGAGGCTCCATGG + Intronic
991064280 5:62409446-62409468 TAGATGTCAGAGGGATGCCAGGG - Intronic
993825419 5:92679581-92679603 CAGATGGTAGAGGTGTTTCCTGG - Intergenic
995464235 5:112434781-112434803 CAGATGCTGGAGCAGTTCCAGGG + Intergenic
997835059 5:137185418-137185440 CATCTGTGAGAGGAGTTCCAGGG - Intronic
997980760 5:138466199-138466221 CATGTGTTAGAGGGATGCCAAGG + Intronic
999648915 5:153746601-153746623 CAGAGGTGAGATGGGCTCCAAGG - Intronic
1002437422 5:179240128-179240150 CAGATGTTGGAGGTGTTCAGAGG + Intronic
1003172875 6:3733842-3733864 CAGATGTTGGCGGGCTGCCATGG - Intronic
1009245476 6:61231838-61231860 CATAGGTCAGAGGGGTCCCACGG + Intergenic
1010158282 6:72821140-72821162 CAGATGGTAGAGGTGTGTCAGGG + Intronic
1011489101 6:87872337-87872359 ACAATGTTAGAGGGATTCCAAGG + Intergenic
1013205119 6:107937684-107937706 CAGATGCTAGGGAGGTTACAGGG - Intronic
1016948986 6:149562177-149562199 CAGGAGCTAGAGGGGCTCCAGGG - Intergenic
1018993683 6:168694202-168694224 CAGAAGACCGAGGGGTTCCAAGG - Intergenic
1018995584 6:168707627-168707649 CAGATTTGAGATGGGTTCAAAGG + Intergenic
1020363165 7:7351818-7351840 CAGATGGTAGAGGGGGGCCTTGG - Intergenic
1022140200 7:27487046-27487068 TAGATGTGGGAGGGGGTCCAGGG - Intergenic
1022176266 7:27874637-27874659 TAGATGTTAGATGTGTTCTATGG - Intronic
1030689846 7:112520921-112520943 CAGGTGGTAGCAGGGTTCCATGG + Intergenic
1031667686 7:124504850-124504872 CATATGTTAAATGGGTTCAAAGG - Intergenic
1034938644 7:155215914-155215936 CATATGAGAGAGGGGATCCAAGG - Intergenic
1037129856 8:15394737-15394759 CAAATGTTAGTGGAGGTCCAAGG + Intergenic
1039399075 8:37253312-37253334 CAAATGTCAGAGAGGGTCCAGGG + Intergenic
1040798998 8:51320835-51320857 CAGATGTTAGAGGGGTTCCAAGG - Exonic
1046309134 8:112412116-112412138 AAGATGTTACAGTGGTTCAAAGG - Intronic
1048562582 8:135557518-135557540 CAGATGTTCCAGTGGTTCGAGGG + Exonic
1050165238 9:2758474-2758496 CAGAGGTTAGAGTTTTTCCAAGG + Intronic
1053386447 9:37694377-37694399 AAGATGTTAAGAGGGTTCCAAGG - Intronic
1053806993 9:41812881-41812903 CAGATGCTAGTGAGGTTGCAGGG - Intergenic
1054623599 9:67374546-67374568 CAGATGCTAGTGAGGTTGCAGGG + Intergenic
1055732512 9:79292973-79292995 CAGAAATCAGAGGGATTCCAAGG + Intergenic
1055846164 9:80565691-80565713 CAGACATTAGAGAGGTTCCTTGG + Intergenic
1057796987 9:98164844-98164866 CGGATTGTGGAGGGGTTCCAGGG + Intronic
1061204869 9:129157034-129157056 CAGATCTTAGTGGCGTCCCAGGG + Intergenic
1062240438 9:135534697-135534719 CAGGTGTTTGAAGGGTTCCCAGG - Intergenic
1202629490 M:4826-4848 CGGATGTCAGAGGGGTGCCTTGG - Intergenic
1186111621 X:6263442-6263464 CACATGTTAGAGGAGTCCCATGG - Intergenic
1187155053 X:16714146-16714168 CAGATGAGAGAAGGGCTCCAAGG + Intergenic
1187628454 X:21142366-21142388 GAAATGTCAGTGGGGTTCCAGGG + Intergenic
1187855967 X:23636605-23636627 GGGATGTTAGTGGGGCTCCAGGG - Intergenic
1189223643 X:39394715-39394737 CAGATGCCAAAGGGGTTCAATGG + Intergenic
1189603227 X:42649074-42649096 GAGATGATAGAGGGGTGCAATGG - Intergenic
1189863148 X:45294076-45294098 CAGATTTTAGAGACATTCCAAGG - Intergenic
1190954554 X:55179780-55179802 CAGGTATTAGAGAGGTTCCTTGG + Intronic
1194929327 X:99867244-99867266 CAGATGTTAGGGAAGTTCCGTGG - Intergenic
1195024037 X:100857518-100857540 CAGATGTTGGTGAGGTTGCAAGG - Intronic
1197636910 X:128925702-128925724 CAGAAGTTAAAGGGGTAGCAAGG + Intergenic
1197944758 X:131827202-131827224 CAGCTTTTAGAGGGCTTACAAGG + Intergenic