ID: 1040807773

View in Genome Browser
Species Human (GRCh38)
Location 8:51412787-51412809
Sequence GAACACACCTTGGTATAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040807773_1040807775 12 Left 1040807773 8:51412787-51412809 CCAGTTTATACCAAGGTGTGTTC 0: 1
1: 0
2: 0
3: 12
4: 88
Right 1040807775 8:51412822-51412844 ATTCTCAATTCACACATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040807773 Original CRISPR GAACACACCTTGGTATAAAC TGG (reversed) Intronic
906054732 1:42906597-42906619 GAGCATACCTTTGTAGAAACAGG + Intergenic
909437729 1:75662979-75663001 GAACTAATCTTTGTATAAACAGG - Intergenic
909816176 1:79996723-79996745 GAAATAACCTTGGTATTAACAGG - Intergenic
917230872 1:172836075-172836097 GAACTCACTGTGGTAAAAACTGG - Intergenic
921832252 1:219741282-219741304 GAACATTCCTTGGAATAAAATGG + Intronic
1063345398 10:5307239-5307261 GAACACATCTTTGTTTACACCGG + Intergenic
1066054406 10:31667014-31667036 AAACACAGCCTGGTATAAAGGGG + Intergenic
1070127104 10:73631247-73631269 AAACCCACTTTGGTATAATCTGG + Intergenic
1070197778 10:74174931-74174953 GAAAACAGATTTGTATAAACTGG + Intronic
1070784545 10:79155427-79155449 GATCACACCATGATAAAAACGGG - Intronic
1074204941 10:111275073-111275095 GAAAACAGCTTGATAGAAACTGG + Intergenic
1078308161 11:10211872-10211894 AAACAGAACTTGGTAGAAACAGG - Intronic
1081161214 11:39751460-39751482 GAATACACCTTAGTATACAAAGG - Intergenic
1081515581 11:43825252-43825274 GAATACACTGTGGTATAAAAAGG - Intronic
1084595927 11:70117044-70117066 GAACACACTTTGGGAAACACTGG + Intronic
1086781443 11:90911184-90911206 CAACACACTTTGGGATAAAAAGG + Intergenic
1087097186 11:94330535-94330557 GAACAGAACTTGGGAGAAACAGG + Intergenic
1089778828 11:120858701-120858723 GAACACACTTTGATAAATACTGG + Intronic
1090025613 11:123165230-123165252 TAGCTAACCTTGGTATAAACAGG + Intronic
1091619537 12:2075873-2075895 GAACCCATTTTGGTATAAACAGG + Intronic
1092750056 12:11710428-11710450 GAAAATACCATGGAATAAACAGG - Intronic
1095864863 12:46960519-46960541 GAAGAGACTTTGGTATAAATAGG - Intergenic
1096014075 12:48251463-48251485 GAACAATCTTTGGTATAAATGGG - Intergenic
1098148239 12:67519632-67519654 GCACACACATTGGCATAAGCAGG + Intergenic
1099037423 12:77606298-77606320 GAACAAACCATGCTATTAACTGG + Intergenic
1104730747 12:131104065-131104087 GAACACACCTGGGGATTAAGCGG - Intronic
1111115753 13:83774736-83774758 GAACGGAGCTTGGTATAAAAGGG - Intergenic
1112712734 13:102149241-102149263 GAACACTCATTGATATAAAATGG + Intronic
1115441831 14:33444532-33444554 AAAGACATCTTGGTCTAAACTGG + Intronic
1116246483 14:42420711-42420733 GAACACAATTTTGTAAAAACTGG + Intergenic
1117260208 14:54024873-54024895 GAACACACAGTGGTGAAAACTGG - Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1125094973 15:35840120-35840142 TAACACACCTGGGAATTAACTGG + Intergenic
1130151384 15:81314367-81314389 GAACACAACTTGGTAGGGACAGG + Intronic
1130407491 15:83614690-83614712 GAAGCCACCTTGGTACAACCTGG + Intronic
1130630488 15:85563074-85563096 GATCAGACCATGGTATAAATGGG + Intronic
1135681442 16:24460691-24460713 GACCACACCTTGGTTTAACAGGG + Intergenic
1146706264 17:35002822-35002844 GAACACAACCTGGGCTAAACTGG - Intronic
1150786462 17:68167087-68167109 GTACACAAATTGATATAAACTGG + Intergenic
1155020377 18:21890869-21890891 GAAGTCACTCTGGTATAAACAGG + Intergenic
1156171603 18:34493500-34493522 GCACACACCTTGGAATGGACGGG - Intronic
1156763272 18:40619760-40619782 CAACACATCTTAGAATAAACAGG + Intergenic
1158733469 18:60052801-60052823 GAACAAACTTTGGTGTGAACTGG - Intergenic
1161162422 19:2768674-2768696 GAACACACCTTGGTGGAAGATGG + Intronic
926277409 2:11414985-11415007 GTATAAAACTTGGTATAAACAGG + Intergenic
926617006 2:15006373-15006395 GAAAACACCTAGGTATTAATGGG + Intergenic
930172360 2:48264823-48264845 GAACCCAGCCTGGTATAACCTGG - Intergenic
930995973 2:57718469-57718491 GAACAAATTTTGGTAAAAACTGG + Intergenic
943891208 2:193289741-193289763 GAACACACCGTGGGACAAAAGGG - Intergenic
1171019691 20:21574191-21574213 GAACACACAAGGGTACAAACTGG - Intergenic
1172603405 20:36198745-36198767 GAAAACACCTAAGTATAAACTGG - Intronic
1176702151 21:10067452-10067474 GAACAAACCTTGGAACAAACTGG - Intergenic
1177190529 21:17846345-17846367 GAAAATACCTTAGAATAAACAGG + Intergenic
1177749195 21:25258580-25258602 GAACACACTTTTTTGTAAACTGG - Intergenic
1177793357 21:25744712-25744734 GAACACAACTGGTTATAATCAGG - Intronic
1178056186 21:28801062-28801084 GAACACACTGTGGAAGAAACAGG + Intergenic
955236616 3:57144968-57144990 GAAGACAGCTTGGTGTAAATGGG + Intronic
957498325 3:81020150-81020172 GAAATCAGCTTGGCATAAACAGG - Intergenic
964848924 3:161073069-161073091 GAACACACTTTGGGAAACACTGG - Exonic
971139785 4:23911920-23911942 GATCACACCTTTATAAAAACAGG - Intergenic
972028380 4:34417507-34417529 CACCAAAGCTTGGTATAAACTGG - Intergenic
975663299 4:76708549-76708571 GACCACCCATTGGTATAACCAGG - Intronic
977803624 4:101269630-101269652 GAAAACATCTTGGTATTAATAGG + Intronic
978542264 4:109830585-109830607 GAACACACCTGGGGAAGAACAGG + Intronic
978989088 4:115055452-115055474 GCACACACCCTTGAATAAACAGG + Intronic
980374327 4:131923741-131923763 GAACAAACCTTGGAACAAACTGG - Intergenic
984235716 4:177155729-177155751 GAAAACTCCTGGGTAGAAACAGG + Intergenic
1000429690 5:161136398-161136420 GTAGTCATCTTGGTATAAACAGG + Intergenic
1004582415 6:16966864-16966886 GGCCACACATTGGAATAAACTGG + Intergenic
1008134001 6:47752023-47752045 CAACATACCTTGGTATATAATGG - Intergenic
1010287015 6:74090820-74090842 GAACATTCGTTGCTATAAACTGG - Intergenic
1012543284 6:100388178-100388200 GGTCACCCCTTGGTATAAACAGG + Exonic
1013747714 6:113365615-113365637 GAACACACTTTAGTAAACACTGG + Intergenic
1016757886 6:147706749-147706771 AGCCACACCTTGGTATACACAGG - Intronic
1024954492 7:54902299-54902321 GAACACACCTTTGCACACACAGG + Intergenic
1028103614 7:86851190-86851212 GAACACACCTTGGAAAATGCTGG + Intronic
1028880739 7:95876983-95877005 AATCACAACTTGGTAAAAACAGG + Intronic
1030594359 7:111519366-111519388 GAAAATAGCTTGGTATAAAGGGG - Intronic
1035230058 7:157459972-157459994 GAACAGACCCAGGTATAGACTGG + Intergenic
1038296918 8:26301208-26301230 AAATAAACCTTGTTATAAACAGG - Intronic
1038562399 8:28591514-28591536 GAACAACTCTTGGTCTAAACAGG - Intergenic
1039008814 8:33070598-33070620 GAACACTCATTGGAATAAACAGG + Intergenic
1040807773 8:51412787-51412809 GAACACACCTTGGTATAAACTGG - Intronic
1041694694 8:60723510-60723532 GAACACATCTCTGTATAGACGGG + Intronic
1048627889 8:136206333-136206355 GACCCCACCTAGATATAAACTGG - Intergenic
1050649012 9:7755112-7755134 GAAGACAACTTGATACAAACTGG + Intergenic
1050978476 9:11974292-11974314 GAACACACTGTGGAATAAAGTGG + Intergenic
1053639297 9:40053862-40053884 GAACAAACCTTGGAACAAACTGG - Intergenic
1053766781 9:41411242-41411264 GAACAAACCTTGGAACAAACTGG + Intergenic
1054320100 9:63650526-63650548 GAACAAACCTTGGAACAAACTGG - Intergenic
1054545448 9:66322756-66322778 GAACAAACCTTGGAACAAACTGG + Intergenic
1056009792 9:82315581-82315603 AAAGACACCTTTGCATAAACAGG - Intergenic
1059007065 9:110414554-110414576 GAACACATCTTAGGATAAACTGG + Intronic
1059267345 9:113047763-113047785 GAGCACACCCTGATAAAAACAGG + Intronic
1202787168 9_KI270719v1_random:37537-37559 GAACAAACCTTGGAACAAACTGG - Intergenic
1190235037 X:48608581-48608603 CCACAGACCTTGGTAGAAACTGG - Exonic
1196920722 X:120582793-120582815 GAACAGACCTTTGTGTAATCTGG + Intergenic
1200250323 X:154550023-154550045 GAAAACTCCTAGGTATATACCGG - Intronic
1201728437 Y:17180712-17180734 GAAACCATCTTGGTATACACTGG + Intergenic
1201793427 Y:17867574-17867596 GAACACATAGTGGTGTAAACCGG + Intergenic
1201808127 Y:18038412-18038434 GAACACATAGTGGTGTAAACCGG - Intergenic