ID: 1040807926

View in Genome Browser
Species Human (GRCh38)
Location 8:51415205-51415227
Sequence CAGTAGGAATTGTAGAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040807924_1040807926 17 Left 1040807924 8:51415165-51415187 CCACAAGGGTATGTATGAGAATG 0: 1
1: 0
2: 0
3: 10
4: 146
Right 1040807926 8:51415205-51415227 CAGTAGGAATTGTAGAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040807926 Original CRISPR CAGTAGGAATTGTAGAAAAT TGG Intronic
No off target data available for this crispr