ID: 1040809046

View in Genome Browser
Species Human (GRCh38)
Location 8:51430020-51430042
Sequence GGAGACTTCTTGATTGGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040809046 Original CRISPR GGAGACTTCTTGATTGGATC AGG (reversed) Intronic
900934751 1:5758285-5758307 GGAGTCTTCTTGGCTGGGTCTGG - Intergenic
904469735 1:30728974-30728996 GGAGACTTCTTCCTGGGACCCGG + Intergenic
907841582 1:58163128-58163150 GGAGACTCCATGACTGGATAGGG - Intronic
909512838 1:76474383-76474405 CGGGACCTCATGATTGGATCTGG + Intronic
920294678 1:204948679-204948701 AGAGACTTCTTCCTTGGATCTGG + Intronic
922108907 1:222538642-222538664 GGAGACTTCATGAGTGGGTAAGG - Exonic
924816931 1:247451044-247451066 GGAGACTTCTGGCCAGGATCTGG - Exonic
1068051046 10:51949720-51949742 GGAGACTTCTTGATTAAACAAGG - Intronic
1073208717 10:101782025-101782047 GGAGTCTTCATTATTGGAGCTGG + Intronic
1074369567 10:112889003-112889025 GGAGACATAATGATTGGCTCAGG - Intergenic
1078385347 11:10886621-10886643 GAATACTTGTTGATTGAATCGGG + Intergenic
1079686361 11:23363854-23363876 GGAGACTTGTTGAATGGCTTTGG - Intergenic
1079955568 11:26859651-26859673 TGGGACTTCTAGATTGGACCAGG - Intergenic
1082701487 11:56437186-56437208 GGACACTTCATGGTTGCATCAGG - Intergenic
1083144243 11:60746869-60746891 GCAGCCTTCCTGATTTGATCTGG + Intergenic
1087337838 11:96866653-96866675 GGAATCTTCTTGATTGGATGAGG + Intergenic
1087994782 11:104792005-104792027 GGAGACTTCTTCTTTGGAGGAGG - Intergenic
1094003132 12:25718070-25718092 GGAAACATGTTGATTGGAACTGG + Intergenic
1095548543 12:43403289-43403311 GGAGTCTTCTTGATTAATTCTGG + Intronic
1096592682 12:52671724-52671746 AGGCCCTTCTTGATTGGATCTGG + Intergenic
1097331796 12:58339408-58339430 GGAGACTGCTTGCTTCCATCAGG - Intergenic
1097522841 12:60689924-60689946 GCAGACTTGTTGAATGGCTCTGG - Intergenic
1100230417 12:92601052-92601074 AGAGACTTGTTGAATGGATTTGG - Intergenic
1101560330 12:105851248-105851270 GGAGACTTCTTGAATGAATATGG - Intergenic
1110183426 13:72644505-72644527 GGAGAGTTCTTGATTGGTGAAGG - Intergenic
1110671319 13:78182287-78182309 GGAGACATCCTGAATGGATGTGG + Intergenic
1111338962 13:86858679-86858701 GGAGAGGACTTGATTGGATTTGG - Intergenic
1111726943 13:92023201-92023223 TGAGACTTCTAGTTAGGATCTGG + Intronic
1112837600 13:103534977-103534999 GTATAATTCTTGATTGAATCTGG + Intergenic
1120972004 14:90215389-90215411 AGAGACTTCTTGAATGGCTTTGG - Intergenic
1121852426 14:97234042-97234064 AAAGACTTTTTGATTGGCTCAGG - Intergenic
1129412540 15:75358131-75358153 GGAGACTGCTTGTGTGGAACAGG - Intronic
1136643447 16:31588431-31588453 GGAGAGTTCTTGCTGGCATCAGG - Intergenic
1137782224 16:51107376-51107398 GGACACTTCTGTATTGCATCAGG - Intergenic
1138880945 16:61014528-61014550 GGAGGCTTCTTGATAAGTTCAGG - Intergenic
1141122720 16:81373673-81373695 GTAGAATCCTGGATTGGATCTGG - Intronic
1142901586 17:3015447-3015469 GGAGACCTGTTGTTTGGGTCAGG + Intronic
1144245574 17:13360526-13360548 GGAGAATTCTTTTTTGTATCTGG + Intergenic
1148955183 17:51347695-51347717 GGTGACTTTTTGATTGGCTGTGG + Intergenic
1150143423 17:62749181-62749203 GAAGACTTCTTAATTTGACCAGG + Intronic
1152418462 17:80178290-80178312 GCAGACTTCTAGAATGGACCTGG - Intronic
1157571511 18:48715473-48715495 GGAGACCTGTTGCTTGGAACGGG + Intronic
1157846501 18:51008510-51008532 GGAGAATTCTAGATGGGGTCAGG - Intronic
1157984978 18:52427085-52427107 GTAGACTTGGAGATTGGATCTGG - Intronic
1160817363 19:1042320-1042342 GGAGACTGCTTGGTTGGTTGAGG - Exonic
1162751654 19:12833480-12833502 GGGGAGTTCTTGATTGGACAGGG + Intronic
932064018 2:68534097-68534119 TAGGACTTCTTGCTTGGATCTGG + Intronic
932659110 2:73636942-73636964 AGAGACTTCTTTATTGTATTTGG - Intergenic
932665703 2:73696925-73696947 AGAGACTTCTTTATTGTATTTGG - Intergenic
933172789 2:79141946-79141968 GGAGACTTCTTTATTGTACCTGG + Intergenic
937631169 2:124102648-124102670 GGAGACTCCTTTATTGGAACTGG - Intronic
945005191 2:205397961-205397983 GGAGAAGTCTTGAATGTATCAGG + Intronic
946283063 2:218680458-218680480 GGAGACTTCTTTCTGGGATGTGG - Intronic
946356280 2:219187534-219187556 GAAGACTTCTTGACTGTATCAGG - Intergenic
948327391 2:237136918-237136940 GTGGGCTTCTGGATTGGATCTGG - Intergenic
1174736149 20:52968003-52968025 GGATACTTGTTTATAGGATCAGG - Intergenic
1179357154 21:40671350-40671372 GGAGACTTTTTTATTTGTTCAGG - Intronic
1180604696 22:17048621-17048643 GGAGCCTTCTTGAGTGGAGAGGG + Intergenic
1181874397 22:25928655-25928677 GGAGTCTTCTGTATTGTATCAGG - Intronic
949892424 3:8743366-8743388 GGGGACTTCGGGATTGGAACAGG - Intronic
953348080 3:42192769-42192791 GGAGCCTTCCTGATTTGTTCTGG + Intronic
954317400 3:49808576-49808598 GGGGGCTTCTTGATTTGATCAGG - Intronic
955700029 3:61672932-61672954 GGAGGATTCTTGATTGGCCCAGG + Intronic
958696799 3:97538286-97538308 AGTGACTTCTTGATTGTATAGGG + Intronic
958995825 3:100904001-100904023 GGAAACTTGTTGATTTGATTTGG - Intronic
961738489 3:129017215-129017237 GGCGGCTTCATGATTGGCTCAGG + Intronic
963851146 3:150211533-150211555 GGAAAATTCTTGTTTGGAACAGG - Intergenic
964003537 3:151805861-151805883 GTAGACGTCTTGACTGCATCCGG - Intergenic
971495789 4:27263845-27263867 GGTGACTCCTTGTTTGTATCTGG - Intergenic
971503278 4:27339719-27339741 GAAGACTTCATCATTGCATCAGG + Intergenic
972324203 4:37999625-37999647 GGAGACATTTGGGTTGGATCTGG + Intronic
976715562 4:88119490-88119512 AGAGACTTGTTGATTGGCTTTGG + Intronic
976909252 4:90280287-90280309 GGTGACTTCATGATTTGTTCAGG - Intronic
987894904 5:23931777-23931799 AGAGCCTTCTTGGTTTGATCAGG + Intergenic
992860613 5:80905558-80905580 GGAGAGTTGTTGAATGGATATGG + Intergenic
993140862 5:84031542-84031564 GGAGTCTTCATGAATGGAACTGG + Intronic
997602535 5:135150320-135150342 GGAGATTTCTTGAGTAGCTCAGG - Intronic
998261490 5:140635144-140635166 TGAGCCTTCTTGTTTGGATTGGG - Intergenic
999856319 5:155598503-155598525 GGAGACTTAAGGATAGGATCAGG + Intergenic
1000260831 5:159586989-159587011 GGACACTTCTAGAATGGGTCTGG - Intergenic
1002959455 6:1900166-1900188 GGAGCCTTCTTCATTGGACGGGG + Intronic
1010174148 6:73007078-73007100 GGAGACTTCCTTTTTGGATGTGG - Intronic
1012297948 6:97547894-97547916 GGAGTCTTCATGATTGGAATTGG - Intergenic
1012681957 6:102193585-102193607 GGAGAATTGTTGATTCTATCTGG - Intergenic
1022182224 7:27931961-27931983 GGTGACTTCTTGAATGTATTTGG + Intronic
1022868753 7:34452327-34452349 AGAGACTGGTTGATTGGACCGGG + Intergenic
1033232760 7:139614443-139614465 GGAGACTTCGGGATTGGCTAAGG + Exonic
1040809046 8:51430020-51430042 GGAGACTTCTTGATTGGATCAGG - Intronic
1041138489 8:54788083-54788105 GTAGACTTCCTGATAGGATGGGG + Intergenic
1044897834 8:96911453-96911475 GGGGACTTCTTATTTGGATGAGG - Intronic
1048851653 8:138651165-138651187 GAAGACTTCCTGATTGCCTCAGG + Intronic
1052267508 9:26591294-26591316 GGAGACTTGTTGAATGGCTTTGG - Intergenic
1057760539 9:97870375-97870397 GAAGACTTCTTTATTGGATTTGG - Intergenic
1058880131 9:109278531-109278553 AGATACTTCCTGATTGTATCTGG - Intronic
1062008289 9:134252729-134252751 GGTGACTCCTGGCTTGGATCCGG + Intergenic
1185509472 X:652385-652407 GGAAAGTTCATGATTGGATTTGG + Intronic
1185750648 X:2608151-2608173 GGAGACTTCCTGCTTCGAACTGG + Intergenic
1191936703 X:66434796-66434818 TGAGACTTCTTGATTGTTACAGG + Intergenic
1191941924 X:66489953-66489975 GGAGAGCTCTTGCTTGCATCTGG + Intergenic
1195217604 X:102715678-102715700 ATAGGCTTCTTGCTTGGATCTGG - Exonic
1195861311 X:109386317-109386339 GGACCCTTCTTGATTGAGTCAGG - Intronic
1196075186 X:111568462-111568484 GGAGACTTCTAGGTTGGCCCTGG + Intergenic
1197900336 X:131364836-131364858 GAAGAGTTCTTGACTGGGTCTGG - Intronic