ID: 1040809550

View in Genome Browser
Species Human (GRCh38)
Location 8:51436491-51436513
Sequence CAGTGGGATCACATGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 486}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040809550_1040809556 20 Left 1040809550 8:51436491-51436513 CCTTCTTCCATGTGATCCCACTG 0: 1
1: 0
2: 0
3: 22
4: 486
Right 1040809556 8:51436534-51436556 AATTGAAAATCAACTCCAAAAGG No data
1040809550_1040809552 -8 Left 1040809550 8:51436491-51436513 CCTTCTTCCATGTGATCCCACTG 0: 1
1: 0
2: 0
3: 22
4: 486
Right 1040809552 8:51436506-51436528 TCCCACTGTTCAGACCACAGTGG 0: 1
1: 0
2: 0
3: 19
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040809550 Original CRISPR CAGTGGGATCACATGGAAGA AGG (reversed) Intronic
900159428 1:1216474-1216496 CAGTGGGAGCTCAGGGAAGCCGG - Intergenic
901249882 1:7770125-7770147 CAGATGGATTAGATGGAAGAGGG - Intergenic
902105268 1:14030377-14030399 CAGTGAGATCACATGGACACGGG + Intergenic
902730343 1:18364878-18364900 CAGTGGAACCACATGGGAAATGG - Intronic
903266224 1:22159670-22159692 CAGTTGGTTCCCATGGAAAACGG + Intergenic
903789105 1:25880737-25880759 CAGTGGGAGCACAATGAAGCAGG + Intergenic
905016649 1:34782602-34782624 GAGTGGGATAGCATGGAACACGG - Intronic
905521228 1:38602083-38602105 CAGTGGAATTACATGGCAGCAGG + Intergenic
905647474 1:39634420-39634442 CAGTTGGACCACCTGAAAGATGG - Intronic
906064161 1:42968311-42968333 TAGTGGGTTCAGATGGATGATGG - Intergenic
907248924 1:53125118-53125140 CTGTGGCAGCACACGGAAGACGG + Intronic
907304890 1:53507935-53507957 CATGGGGCTCACATGGAAGACGG - Intronic
907905199 1:58778185-58778207 AAGTAGGATCTCATAGAAGAGGG - Intergenic
908040193 1:60104496-60104518 CTGTGGCATCACATGATAGAAGG - Intergenic
908140769 1:61182295-61182317 CACTGGGATCTCTTGGAAGCTGG + Intronic
908638620 1:66196756-66196778 CAGTGAGATCACATGGACACAGG + Intronic
909239389 1:73192840-73192862 CTGTGTCCTCACATGGAAGAAGG + Intergenic
911102717 1:94106913-94106935 CAGAGGGCTCACAGGGCAGAAGG - Intronic
911106834 1:94140042-94140064 CAGTGGGAACACATGGACACAGG + Intergenic
912039307 1:105367136-105367158 CAATTTAATCACATGGAAGAGGG - Intergenic
912131018 1:106600480-106600502 CAGAGTCATCACATGGCAGAAGG - Intergenic
913467940 1:119161850-119161872 CAGTGAGATCACATGGACACAGG + Intergenic
913501368 1:119475576-119475598 CAGTGGGGTAACGTGGAAAATGG + Intergenic
913505962 1:119516426-119516448 CAGTAGGGTAACATGGAAAATGG + Intergenic
913732918 1:121736351-121736373 CAATGAGATCACATGGAAACAGG + Intergenic
913769257 1:122229670-122229692 CAATGAGATCACATGGAAACAGG + Intergenic
916205777 1:162315109-162315131 CCTTGGAATCACATGGATGATGG + Intronic
916705478 1:167345009-167345031 CAGTGGGAACACATGGACACAGG + Intronic
916804644 1:168247366-168247388 CAATGAGAACACATGGAAAAGGG - Exonic
917061994 1:171051535-171051557 CAATGAGAACACATGGAAAAAGG + Intronic
917228193 1:172806672-172806694 CAGTGAGATCACATGGACACAGG - Intergenic
917244057 1:172981470-172981492 CAGTGAGATCACATGGACACAGG - Intergenic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
919998139 1:202773175-202773197 CAGTGGGCTCACATATCAGAGGG - Exonic
920997806 1:211011793-211011815 CAGAGGCTTCACATGGAAGACGG - Intronic
921340584 1:214129851-214129873 CAGTGGGTTAAGATGTAAGAAGG + Intergenic
921535358 1:216342784-216342806 CAATGAGAACACATGGACGAAGG + Intronic
922597412 1:226824546-226824568 CTGTGGGAGCACGTGGGAGACGG - Intergenic
923544041 1:234911344-234911366 CAATGGGATCACATGGACATGGG + Intergenic
924136356 1:240971169-240971191 CTGTGGCCTCACATGGTAGAAGG - Intronic
924771300 1:247082239-247082261 CAGTGAGAACACATGGATGCAGG - Intergenic
1063588366 10:7373230-7373252 CAGAGAGATCACATGGAAAGAGG - Intronic
1064522062 10:16212757-16212779 GAGCGAGATCACATGCAAGATGG - Intergenic
1066007134 10:31155762-31155784 CAGTGCCATCACATGGCAGGTGG - Intergenic
1066713990 10:38266781-38266803 CAGTGAGAACACATGGATGCAGG + Intergenic
1068398435 10:56495187-56495209 CAGTGGGAACACATGGAAACAGG + Intergenic
1068616958 10:59129485-59129507 GAGTGCAATCACATGGAAGCAGG + Intergenic
1069827941 10:71265748-71265770 CAGTGGAAGCACAGGGAAGGTGG - Intronic
1070578844 10:77703404-77703426 CTGTGTGACCACATGGCAGAAGG - Intergenic
1071414488 10:85428491-85428513 CAATGAGAACACATGGAACATGG - Intergenic
1072029910 10:91509071-91509093 CAGTGAGATCACATGGACACAGG + Intronic
1072871878 10:99128628-99128650 CAGTGAGAACACCTGGAACAGGG + Intronic
1073485849 10:103818779-103818801 GGGTGAGATCACATGGGAGAAGG - Intronic
1073591740 10:104764341-104764363 CATTGGCATCACCTGGAAGCTGG - Intronic
1073987832 10:109229419-109229441 CAATGGGATCACATGGACACAGG + Intergenic
1074009130 10:109458673-109458695 CAGTGTCATCCCATGGAAGAAGG + Intergenic
1074180875 10:111061590-111061612 CAGTGGCATCCTACGGAAGAGGG + Intergenic
1074244987 10:111680717-111680739 CAGTGTCCTCACATGGCAGAAGG - Intergenic
1074740214 10:116479236-116479258 CAGTGGTACCACAGAGAAGACGG + Intergenic
1075174725 10:120148880-120148902 CAGTGGTTTTACATGGAGGATGG - Intergenic
1076072471 10:127501724-127501746 CAGTGTGGTCACATGGAAACAGG + Intergenic
1076248424 10:128965688-128965710 CCATGGGATTACCTGGAAGATGG - Intergenic
1076673950 10:132138013-132138035 CATTTGGATGACAGGGAAGACGG - Intronic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1078067774 11:8089468-8089490 CAGTGAGCCCACATGGTAGAAGG - Intronic
1079563164 11:21848121-21848143 CAGTGGGAACACATGGACACAGG - Intergenic
1079843331 11:25430946-25430968 CAGTGAGAACACATGGAGAAAGG + Intergenic
1080501252 11:32873491-32873513 CTGTGTGATCTCATGGCAGAAGG - Intergenic
1080855660 11:36109372-36109394 CAGTGGGAACATATGGGGGATGG + Intronic
1080987857 11:37492553-37492575 CAATGGGATCACATGGACACAGG - Intergenic
1081094039 11:38909571-38909593 CAATGAGAACACATGGAATAGGG + Intergenic
1081445576 11:43128785-43128807 CTGTGTCATCACATGGAGGAAGG - Intergenic
1082749119 11:56998943-56998965 CAGTTGGAGCACAGAGAAGAAGG + Intergenic
1083518880 11:63288138-63288160 CAGTGAGAACACATGGATGCAGG + Intronic
1083744037 11:64725379-64725401 CAGTGGGGACACATGGGGGAGGG + Intergenic
1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG + Intronic
1085737953 11:79055820-79055842 CAGTGAGATAACTTGGAAGGAGG - Intronic
1085856628 11:80182665-80182687 CAGTGGGATCATTTGGGGGATGG - Intergenic
1085930520 11:81077219-81077241 CAGTGGGAAGACAGAGAAGAAGG - Intergenic
1087190067 11:95244875-95244897 CAGTGGCATCACAGGTAAGAAGG + Intergenic
1087448468 11:98286122-98286144 CTGTGACATCACATGGCAGAAGG - Intergenic
1087560468 11:99783767-99783789 CAGTGAGATCACATGGACACAGG + Intronic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1089658800 11:119972194-119972216 CAGTGCCCTCACATGGCAGAAGG - Intergenic
1090250123 11:125245192-125245214 CATGGGGATCACATGGCATAAGG - Intronic
1090675430 11:128989754-128989776 CAATGAGAACACATGGAATAGGG - Intronic
1091636985 12:2204740-2204762 CAGTGAGATCACATGGACACAGG + Intronic
1091888891 12:4037069-4037091 AAGAGCTATCACATGGAAGAGGG - Intergenic
1092023251 12:5220239-5220261 CACTGGAATCACAAGGAAGGAGG - Intergenic
1092325055 12:7522092-7522114 CAGTGAGATCACATGGACACAGG - Intergenic
1093158997 12:15722751-15722773 CAGTGTCCTCACATGGCAGAAGG + Intronic
1093241515 12:16682589-16682611 CAGTGGGTAAACATGGTAGAGGG - Intergenic
1093632395 12:21425018-21425040 CAATGAGATCACATGGAAACAGG + Intergenic
1093887284 12:24476649-24476671 CAGTGTGGTAACTTGGAAGAGGG - Intergenic
1093980735 12:25472479-25472501 CAATGGGAGCAAATGGAAAAAGG + Intronic
1094005313 12:25742911-25742933 CTGTGCCCTCACATGGAAGAGGG + Intergenic
1094859516 12:34446227-34446249 CAGTGAGATCACATGGACACCGG - Intergenic
1096594421 12:52685547-52685569 AGGGGGCATCACATGGAAGAAGG + Intergenic
1096952658 12:55489818-55489840 CAGTGAGATCACATGGACACAGG + Intergenic
1096953808 12:55504889-55504911 CAATGAGAACACATGGAAGCAGG - Intergenic
1097528896 12:60773789-60773811 CAGTGAGAACACATGGACGCAGG - Intergenic
1099073009 12:78070746-78070768 CAGTGAGATCACATGGACACAGG - Intronic
1101961954 12:109257339-109257361 AAGTGTTTTCACATGGAAGAAGG - Intronic
1102463859 12:113116451-113116473 CAATGGGAACACATGGGAGGAGG + Intronic
1102517044 12:113456689-113456711 CAGTGGCATCACCTGGGAGCTGG - Intergenic
1104151014 12:126083381-126083403 CAATGGGAACACATGGACGCAGG + Intergenic
1104203741 12:126616820-126616842 TAGTCGTATCAGATGGAAGATGG + Intergenic
1104461106 12:128956844-128956866 CAGTGGGATCCCCTTGAAGTTGG + Intronic
1106865520 13:33960030-33960052 CAGTGAGTTCACATGGGAGCTGG - Intronic
1106967572 13:35089857-35089879 CAGTGAGATCACATGGACACAGG + Intronic
1107476448 13:40740733-40740755 CAGTGAGATCACATGGACACAGG + Intronic
1108423560 13:50274943-50274965 CAGTGGGATGACTTTAAAGATGG - Intronic
1108679508 13:52767387-52767409 CTGTGTCTTCACATGGAAGAAGG - Intergenic
1109269489 13:60238510-60238532 CAGTGGGATCCCGTTGAAGGTGG + Intergenic
1109973569 13:69802060-69802082 CAGTGAGAACACATGGACGCAGG - Intronic
1110041675 13:70767838-70767860 CAGTGGGATCTCATGGACACGGG + Intergenic
1110076810 13:71256238-71256260 CTGTGTGCTCACATGGCAGAAGG + Intergenic
1110655703 13:77996173-77996195 CATAGGGATCACATGGGAGCTGG - Intergenic
1112828271 13:103417683-103417705 CAGGCGGCTCACATGGATGAAGG + Intergenic
1112831679 13:103460150-103460172 CAGTGAGATCACATGGACACAGG + Intergenic
1112884031 13:104147007-104147029 CTGTGTGCTCACATGGTAGAAGG + Intergenic
1114616319 14:24070335-24070357 CAGTGGGAGCACATTAAAGCAGG - Intergenic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1115153423 14:30311718-30311740 CAGTTGAATCATATGAAAGATGG + Intergenic
1116373023 14:44160064-44160086 CAGTGAGATCACATGGACACCGG + Intergenic
1116532588 14:45991216-45991238 CAGTGAGATCACATGGACACAGG - Intergenic
1117718118 14:58601442-58601464 CAGTGGCATCAACTGGCAGATGG - Intergenic
1117841242 14:59862647-59862669 CAGTGGGAACAGATGGGAAATGG - Intronic
1118074656 14:62284690-62284712 CAGTGGGAACACATGGATACAGG - Intergenic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1118646819 14:67848467-67848489 CTGTGGGATTACATGTGAGATGG + Intronic
1119139182 14:72250037-72250059 CAGTGAGATCACATGGACACAGG + Intronic
1120020144 14:79520488-79520510 CAATGAGAACACATGGAACAGGG - Intronic
1120862479 14:89267196-89267218 CAGTGGGTTCTCAGGGTAGACGG + Intronic
1121086811 14:91152969-91152991 CAGTGGGATAAACTGGAAGAAGG + Intronic
1121436679 14:93925218-93925240 CCGTGGGATCTCAAGGAAGCTGG + Exonic
1121626764 14:95390876-95390898 CTGTGGCACCACATGGCAGAAGG - Intergenic
1122377336 14:101272012-101272034 CAGTGAGATCACATGGACACAGG + Intergenic
1124119511 15:26876692-26876714 CAGTGAGTTTTCATGGAAGACGG + Intronic
1126200343 15:45978678-45978700 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1127284102 15:57517655-57517677 GAATGGCATCACATGGCAGAAGG + Intronic
1128348100 15:66867492-66867514 CAGTTGGAGCACAGGAAAGATGG + Intergenic
1128537856 15:68504140-68504162 CATTGGTCTCACTTGGAAGACGG + Intergenic
1128858710 15:71045888-71045910 CACTGTGCACACATGGAAGATGG - Intronic
1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG + Intronic
1130412917 15:83662370-83662392 CAGTGAGATCACATGGACACAGG + Intronic
1130618855 15:85439767-85439789 CAGTGAGATCACATGGACCCAGG + Intronic
1130777410 15:86999415-86999437 CAGTGAGATCACATGGACACAGG - Intronic
1131181156 15:90241005-90241027 CAGAAGGATCTCATGGCAGAAGG + Exonic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1133430733 16:5734795-5734817 CAGTGGGAGCTCATCCAAGAAGG + Intergenic
1134062582 16:11208043-11208065 CAGGAGGATCCCATGGAAAAGGG - Intergenic
1134848687 16:17462415-17462437 CAGAGGCATCACAAAGAAGATGG - Intronic
1135139883 16:19912235-19912257 CACTGGGATCACGGGGAAGCGGG - Intergenic
1135267850 16:21042865-21042887 CAGTGAGATCACATGGACACAGG - Intronic
1135298812 16:21306767-21306789 CAGTGAGAACACATGGACGCAGG - Intergenic
1135641642 16:24124826-24124848 CAGTGGGAATACAGGAAAGAGGG - Intronic
1135784576 16:25337115-25337137 CAATGAGATCACATGGACGCAGG - Intergenic
1137446292 16:48534612-48534634 CACAGGGACCACAAGGAAGATGG - Intergenic
1137983667 16:53090534-53090556 CTGTGGGATCACGTGTATGACGG + Intronic
1138182135 16:54948595-54948617 GAGTGGGGTCAGATGGAAGAAGG - Intergenic
1138390660 16:56668040-56668062 CAGTGGGTGCACGTGGAAGGCGG + Exonic
1139509660 16:67419892-67419914 CAGGAGGGTCACATGGGAGAAGG + Intergenic
1140110714 16:72002163-72002185 CAGTAGGATCACTTGGCAGTAGG + Intergenic
1140231328 16:73119592-73119614 CTGTTGGCTCACATGGAACATGG - Intergenic
1141245583 16:82303613-82303635 CAGTGAGAACACATGGAAACAGG - Intergenic
1141266270 16:82500369-82500391 CAGTGAGATCACATGGACACAGG + Intergenic
1142169600 16:88614839-88614861 CAGTGGGGTCTCAGGGGAGAAGG - Intronic
1143902486 17:10184583-10184605 CAGTGGCATCACCTGGGAGCTGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1147948114 17:44091935-44091957 CAGTGGGAGCTCAGGGTAGAGGG - Intronic
1148971937 17:51491261-51491283 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1150415370 17:64983882-64983904 CAGTGGCCTCACGTGGAGGAAGG - Intergenic
1150796302 17:68240154-68240176 CAGTGGCCTCACATGGCAGAAGG + Intergenic
1151994869 17:77602228-77602250 CAGAGGGAGCACATGACAGATGG - Intergenic
1152334139 17:79690721-79690743 CAGTGGGATGACGAGGAGGATGG + Intergenic
1153105005 18:1516374-1516396 CAATGAGATCACATGGACGCAGG - Intergenic
1153818901 18:8815417-8815439 CAGTGAGATCACATGGACACAGG + Intronic
1154346838 18:13549636-13549658 CAGTGGGTTCTGCTGGAAGAGGG + Intronic
1154393824 18:13968960-13968982 CTGTGGCATCACATGGTGGAAGG + Intergenic
1155071659 18:22322112-22322134 TTGTGGAATCACATGGAAGAAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156083737 18:33374147-33374169 CAGTGGAAACATCTGGAAGAGGG + Intronic
1156423324 18:36980031-36980053 CTGTGTCATCACATGGCAGAAGG - Intronic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157026417 18:43849533-43849555 CAGTGAGAACACATGGACGCAGG - Intergenic
1157439817 18:47702152-47702174 CAGTGTGATCATCTGGAAAATGG + Intergenic
1158149787 18:54355530-54355552 CAGTGTCCTCACATGGAAGAAGG - Intronic
1158251584 18:55494320-55494342 CTGTGGAATCACATGAAAGGTGG + Intronic
1158351317 18:56567342-56567364 CAGTGGCATCACTTGGGAGTTGG - Intergenic
1158396220 18:57080146-57080168 CTGTGTGCTCACATGGCAGAAGG - Intergenic
1158898008 18:61933714-61933736 CAATGGGAGCACAGGGAATAGGG + Intergenic
1159454598 18:68644707-68644729 CAGTGTCATCCCATGGCAGAAGG - Intergenic
1160878741 19:1310088-1310110 CAATGGGATCACAGGGAAGGCGG - Intergenic
1161659795 19:5539219-5539241 CGGTGGGCTCACAGGGAAGGTGG + Intergenic
1161948433 19:7453573-7453595 CAGGGAGATCGCAGGGAAGATGG + Exonic
1163311394 19:16517044-16517066 CTGTGGGAACACAGGGTAGAGGG - Intronic
1163621479 19:18363447-18363469 CAGTGGGGGCACGTGGACGAAGG - Exonic
1163962920 19:20714112-20714134 CAATGAGAACACATGGAACAGGG + Intronic
1164744478 19:30601073-30601095 CTGTGGGAACACAGGGAATATGG - Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1167219817 19:48191570-48191592 CATTCTGATCACATGGAAAAGGG + Intronic
1167477988 19:49711992-49712014 AAGTGGGAGACCATGGAAGAAGG + Intronic
1168355504 19:55697277-55697299 GGGTGGGATCACATGGAAAGGGG + Intronic
926489492 2:13506439-13506461 CTGTGTCATCACATGGCAGAAGG + Intergenic
926863457 2:17333789-17333811 CTGTGTTATCACATGGCAGAAGG - Intergenic
927106629 2:19833312-19833334 CAATGGGATCACATGGACACAGG + Intergenic
927901781 2:26824868-26824890 CAGTGGAATCACTTGAAACAGGG + Intergenic
929284145 2:40116506-40116528 CAGTGAGATCACATGGACACAGG - Intronic
931831453 2:66055920-66055942 CTGTGTTCTCACATGGAAGAAGG - Intergenic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932552801 2:72788848-72788870 CAGTGGTAGCACAAGGAATATGG - Intronic
933787362 2:85854206-85854228 CACTGGGGTGACATGGTAGATGG + Intronic
933900452 2:86846094-86846116 CACTGGGTTCACAAGAAAGACGG - Intronic
934107220 2:88706500-88706522 CAGTGAGAACACATGGAGGCAGG + Intronic
935780094 2:106503131-106503153 CACTGGGTTCACAAGAAAGACGG + Intergenic
935966731 2:108485118-108485140 CAGTGAGATCACATGGACACAGG + Intronic
937055408 2:118930900-118930922 CTGTGTGCTCACATGGCAGATGG + Intergenic
940980091 2:159991657-159991679 CAGTGAGATCACATGGACACAGG - Intronic
941678556 2:168370746-168370768 CACTGGGCTCACCTGGATGATGG - Intergenic
942724163 2:178988266-178988288 CAGTGAGATCACATGGACACAGG + Intronic
942731095 2:179061376-179061398 CAGTGAGATCACATGGACACAGG - Intergenic
943101954 2:183497662-183497684 CTGTGAGCTCACATGGTAGAAGG - Intergenic
943997361 2:194787140-194787162 CAGTGAGAACACATGGATGCAGG - Intergenic
944282382 2:197912741-197912763 CAGTGAGATCACATGGACACAGG + Intronic
945168158 2:206967852-206967874 AGGTGGGATCACTTGAAAGAAGG + Intronic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
945641283 2:212433903-212433925 TAGTGTCATTACATGGAAGAGGG + Intronic
946672389 2:222119475-222119497 CAATGAGAACACATGGAACATGG - Intergenic
947112751 2:226737136-226737158 CAATGAGATCACATGGATGCAGG - Intronic
947117359 2:226785937-226785959 CAATGAGATCACATGGACGCAGG - Intronic
947243108 2:228017832-228017854 CAGTGAGATCAAGAGGAAGACGG - Exonic
948246660 2:236492054-236492076 CAGTGTCATAACATGGCAGAAGG - Intronic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
1168944862 20:1744817-1744839 CAGTGAGATCACATGGACACAGG + Intergenic
1169729681 20:8773139-8773161 CAGTGGCATCACATGGGGAAGGG - Intronic
1170660931 20:18338873-18338895 CAGTGAGATCACATGGACACAGG + Intergenic
1170690080 20:18606725-18606747 CAGTGAGATCACATGGACACAGG + Intronic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171534055 20:25870603-25870625 CAGTGTCCTCACATGGCAGAAGG + Intergenic
1171948054 20:31396152-31396174 TAGTGGGATCAAGTGGAGGATGG - Intergenic
1172309777 20:33908570-33908592 CAGTGGGATCAGATTGAGGCTGG + Intergenic
1172547992 20:35776620-35776642 CAACAGGATCACGTGGAAGAGGG - Intronic
1172927292 20:38550091-38550113 CAGTGGGAACACATGGACACAGG + Intronic
1173040605 20:39458965-39458987 CAGTGAAAGCCCATGGAAGAGGG + Intergenic
1174422322 20:50407475-50407497 TAGTGGGACCACATGGAATGGGG - Intergenic
1174982534 20:55412516-55412538 CAGTGAGATCACATGGACACAGG + Intergenic
1175440046 20:58983925-58983947 CAGTGGGCTCTCATGGATGAGGG + Intronic
1175648259 20:60694462-60694484 CAGTGGTCTCACATGCAAAATGG - Intergenic
1175744080 20:61441656-61441678 ATGTGTGCTCACATGGAAGACGG - Intronic
1176611572 21:8988804-8988826 AAATGGGATCACATGGACGCAGG + Intergenic
1178911148 21:36674663-36674685 CCATGGGACCACATGGAGGAAGG + Intergenic
1180318043 22:11294202-11294224 CAATGAGAACACATGGAAAAAGG + Intergenic
1180507434 22:16026828-16026850 CAGTGAGATCACATGGACACAGG + Intergenic
1182276838 22:29195271-29195293 CAGTGTGTTCACCTGGAAAATGG - Intergenic
1182537042 22:31012152-31012174 CAGTGAGATCACATGGACACAGG + Intergenic
1182758241 22:32698873-32698895 CAGTGGCATGAGATGGAGGAGGG + Intronic
1183370894 22:37431611-37431633 CAGTGGGATCATTTGGATGTGGG - Intergenic
1184999491 22:48235976-48235998 CACTGGGAGCACGTGGAAGTCGG + Intergenic
950730363 3:14951212-14951234 CAGTGGGTTCACAGGGAATTGGG + Intronic
950847828 3:16031859-16031881 AAGTGGAATCACATGGCACAAGG + Intergenic
950925635 3:16738384-16738406 GAGTGGAATCACATGAAAGCTGG - Intergenic
952117535 3:30200580-30200602 CAGTGAGATCACATGGACACAGG - Intergenic
952294883 3:32052750-32052772 CAATGAGATCACATGGATGCAGG + Intronic
952522138 3:34172040-34172062 CAATGGGAACACATGGAAACAGG - Intergenic
952682078 3:36105362-36105384 CAGTGAGATCACATGGACACAGG + Intergenic
952729287 3:36621669-36621691 CAGTGAGATCACATGGACACAGG - Intergenic
952747814 3:36798131-36798153 CAATGGGAACACTTGGAGGAAGG - Intergenic
955530572 3:59868812-59868834 CAGTGAGCCCACATTGAAGAAGG + Intronic
955762989 3:62309096-62309118 CAGTGAGATTACTTGTAAGAAGG - Intergenic
955800465 3:62680996-62681018 CAGCAGGATCACAGGGAACATGG - Intronic
955995250 3:64673992-64674014 AAGTGGGAACAAATGAAAGAAGG + Intronic
955998062 3:64698364-64698386 CTGTGTCATCACATGGCAGAAGG + Intergenic
956158733 3:66325663-66325685 CAGAGGAATCATATGTAAGAAGG + Intronic
956235800 3:67069507-67069529 CAGACAGAGCACATGGAAGAGGG + Intergenic
957835437 3:85582564-85582586 CAGTGTTCTTACATGGAAGATGG + Intronic
957886146 3:86290156-86290178 CAATGGGATCACATGGACACAGG + Intergenic
958164987 3:89869239-89869261 CAATGGGATCACATGGACACAGG - Intergenic
958201077 3:90315079-90315101 CAGTGAGATCACATGGACACAGG + Intergenic
959030507 3:101294286-101294308 CAGTGAGAACACATGGAAAAAGG - Intronic
959238689 3:103759508-103759530 CAGTGGGAACACATGGACACAGG + Intergenic
960438914 3:117662707-117662729 CAGTGGCATCACCCGGAAAATGG - Intergenic
961427037 3:126856507-126856529 CAGTGGGAGCACAGCTAAGATGG - Intronic
961695852 3:128704029-128704051 CCGTGGCCTCACATGGAGGAAGG - Intergenic
962467482 3:135673874-135673896 CTGTGTGCTCACATGGCAGAAGG + Intergenic
964685564 3:159392502-159392524 CAATGAGATCACATGGACGCAGG - Intronic
965308073 3:167093042-167093064 CAGTGAGATCACATGGACACAGG - Intergenic
966153244 3:176888886-176888908 CTGTGGTTTCACATGGTAGAAGG - Intergenic
966834205 3:184036886-184036908 CCCTGAGCTCACATGGAAGATGG - Exonic
967664874 3:192158964-192158986 CATTGGGATCACAGGAGAGAGGG - Intronic
967753479 3:193141534-193141556 CAATGGGTACATATGGAAGAAGG + Intergenic
967985575 3:195093477-195093499 CAGTGAGATCACATGGACACAGG + Intronic
968926745 4:3552340-3552362 CTGTGTCATCACATGGCAGAAGG - Intergenic
969090364 4:4689553-4689575 CAGTGGCACCACCTGGAAAAGGG - Intergenic
969126654 4:4954084-4954106 CAGTGAGATCACATGGACACAGG - Intergenic
969162512 4:5273789-5273811 CAGTGAGATCACATGGACACAGG + Intronic
969264257 4:6054875-6054897 GGGTGGGATCACCTGGCAGAGGG - Intronic
969594271 4:8140049-8140071 CAGTGAGAACACATGGAAACGGG + Intronic
970002545 4:11378935-11378957 CAGTGAGATCACATGGACACAGG - Intergenic
970334059 4:15014836-15014858 TAGTGGAAGCACAGGGAAGATGG + Intronic
970858793 4:20678298-20678320 CTGTGTGTTCACATGGCAGAAGG + Intergenic
972370844 4:38421903-38421925 CAGTGTCATCACATGGCTGAAGG + Intergenic
972783430 4:42305816-42305838 CAGAGGTGTCACATGAAAGAAGG + Intergenic
972847704 4:43009650-43009672 CTGTGTCATCACATGGTAGAAGG + Intronic
973220738 4:47723277-47723299 CAGGGAGATCACAGAGAAGAGGG + Intronic
973737112 4:53882920-53882942 CAGTGAGATCACATGGACACAGG + Intronic
973948058 4:55980807-55980829 CAGTAGGATTTCATGGGAGATGG - Intronic
974121478 4:57643776-57643798 CAGTGAGATCACATGGACACAGG - Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974796338 4:66755815-66755837 CAGTGTCATCCCATGGCAGAAGG - Intergenic
974955754 4:68639518-68639540 CAGTGAGATCACATGGACACAGG + Intronic
975160109 4:71115133-71115155 CAGTGAGATCACATGGACACAGG + Intergenic
975304460 4:72833260-72833282 CAGTGAGAACACATGGATGCTGG + Intergenic
976337291 4:83905062-83905084 CAGTGGGATCAAAATGAAGCAGG - Intergenic
976437341 4:85033285-85033307 CTGTGTCATCACATGGTAGAAGG + Intergenic
976468107 4:85394667-85394689 CTGTGTCATCACATGGCAGAAGG + Intergenic
976517609 4:85986931-85986953 CAGTGGGAGCTCAGGGAGGAAGG + Intronic
977157196 4:93589245-93589267 CAGTGAGATCACATGGACACAGG - Intronic
977699045 4:100000719-100000741 CAGTGAGATCACATGGACACAGG - Intergenic
977942578 4:102874929-102874951 CTCTGGTATCAGATGGAAGATGG - Intronic
978269408 4:106870964-106870986 CAATGGGATCACATGGACACAGG - Intergenic
978337732 4:107687903-107687925 CAGAGGGACCATAAGGAAGATGG - Intronic
979158696 4:117430212-117430234 CAGAGGGAGTACATGGAAGCTGG - Intergenic
979824011 4:125210619-125210641 CTGTGTCATCACATGGGAGACGG + Intergenic
980781955 4:137502074-137502096 CAGTGAGATCACATGGACACAGG + Intergenic
981618658 4:146669421-146669443 CAGTGAGATCACATGGACACAGG + Intergenic
982684533 4:158472294-158472316 CAGTGAGATCACATGGACACAGG - Intronic
983123722 4:163922162-163922184 CAATGGGAACACATGGATGCGGG + Intronic
983426354 4:167588787-167588809 CAGTGGTATTCCATGGAATAGGG - Intergenic
983557527 4:169071688-169071710 CAGAGCTTTCACATGGAAGATGG - Intergenic
983750250 4:171259445-171259467 CAATGGGAACACATGGAAACAGG - Intergenic
983826526 4:172268789-172268811 CTGTGTTCTCACATGGAAGAGGG - Intronic
983849684 4:172565077-172565099 CTGTGCTCTCACATGGAAGAAGG + Intronic
984585527 4:181560207-181560229 CTGTGGCTTCACATGGCAGAAGG + Intergenic
984621357 4:181956115-181956137 CCGTGTTCTCACATGGAAGAAGG + Intergenic
985902483 5:2807288-2807310 CAGTGAGAACACATGGACGCAGG - Intergenic
986108745 5:4688996-4689018 CAGTGGGAACACATGGAGACAGG + Intergenic
986400970 5:7379703-7379725 CAGGGGCATCACCTGGAAGCGGG - Intergenic
986507745 5:8470467-8470489 CAGTGAAAGCACATGGGAGAGGG - Intergenic
987424464 5:17756871-17756893 CAGAGGGATTACATTGAAGCAGG + Intergenic
987853164 5:23383072-23383094 CAGTGAGAACACATGGACAAGGG + Intergenic
988126612 5:27047477-27047499 CAATGAGATCACATGGACAAAGG + Intronic
988820248 5:34876785-34876807 CAGTGAGATCACATGGACACAGG + Intronic
989100320 5:37817125-37817147 TAGGGAGATCACATGGAGGAAGG + Intronic
989551474 5:42740534-42740556 CAGTGAGATCACATGGACACAGG + Intergenic
989951109 5:50298410-50298432 CAGTGAGATCACATGGACACAGG + Intergenic
990032475 5:51278406-51278428 CAATGAGAACACATGGAACAGGG - Intergenic
990343343 5:54847245-54847267 CAGTGAGAACACATGGACAAAGG + Intergenic
990362687 5:55037171-55037193 CACTGGGATCTCATTGAAGCAGG - Intergenic
990905113 5:60795183-60795205 CAGTGGGATCACAGCCCAGAGGG + Intronic
991511001 5:67376221-67376243 CAGTGGGAACAGATGACAGATGG - Intergenic
991689797 5:69214912-69214934 CTGTGTGCTCACATGGCAGAAGG - Intergenic
993083891 5:83339421-83339443 CAATGGGAACACATGGACGCAGG + Intronic
993354932 5:86894118-86894140 CTGTGTCATCACATGGCAGAAGG - Intergenic
993789691 5:92193662-92193684 CAGTGAGATCACATGGACACAGG - Intergenic
993868138 5:93218960-93218982 CAGTGAGATCACATGGACACAGG + Intergenic
993918906 5:93775680-93775702 CTGTGGGAAAACATGCAAGATGG - Intronic
994581692 5:101650702-101650724 CAGTGGAATTATATGGAAGAAGG - Intergenic
994879795 5:105475514-105475536 CTGTTGGAGCACATTGAAGAGGG + Intergenic
996231924 5:121075202-121075224 CTGTGTGCTCACATGGTAGAAGG + Intergenic
996956128 5:129185845-129185867 CAATGCGATCAACTGGAAGAAGG - Intergenic
997194971 5:131973290-131973312 TCGTGGGACCACAGGGAAGATGG + Exonic
997905512 5:137812593-137812615 CAGTGAGATCACATGGACACAGG - Intergenic
998131125 5:139651459-139651481 CAGTGGGAACCCATGGAACATGG - Intronic
999862289 5:155661305-155661327 CAGTGAGATCACATGGACACAGG + Intergenic
999886680 5:155931954-155931976 CTGTGTGCTCACATGGTAGAAGG + Intronic
1000653143 5:163842899-163842921 CAGTGAGATCACATGGACACAGG + Intergenic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1000720373 5:164698698-164698720 CAATGGGATCACATGGACACAGG + Intergenic
1000911992 5:167033716-167033738 CAGTGGGATCATTTGAAAGTAGG + Intergenic
1001804177 5:174569324-174569346 TAGTGGGTTCACGTGGAACAGGG - Intergenic
1002427552 5:179185184-179185206 CAGTGGGAGGACATGGAGGAAGG + Intronic
1002484400 5:179524431-179524453 CCGTGGGGACACATGGAAGCTGG - Intergenic
1002500175 5:179643057-179643079 CCGTGGGGACACATGGAAGCTGG + Exonic
1002501797 5:179651704-179651726 CCGTGGGGACACATGGAAGCTGG - Intergenic
1002769050 6:273712-273734 CAGAGGGATGTCAAGGAAGATGG - Intergenic
1003827209 6:9966232-9966254 CAATGAGATCACATGGAAACAGG - Intronic
1003994330 6:11523560-11523582 AAACGGGATCACATGGATGAAGG + Intergenic
1004826314 6:19425321-19425343 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1005355495 6:24979394-24979416 GACTGGGATGACTTGGAAGAGGG - Intronic
1005378816 6:25213143-25213165 AAGTGAGAACACATGGAGGAAGG + Intergenic
1005659857 6:27985917-27985939 CAGTGGGAGAACATGGATTAGGG - Intergenic
1005771616 6:29078854-29078876 CAATGAGAACACATGGAACAGGG + Intergenic
1005793700 6:29334034-29334056 CAGTGTCATCACGTGTAAGATGG - Intergenic
1006967042 6:37998225-37998247 CATTAGTATGACATGGAAGATGG + Intronic
1007008898 6:38395444-38395466 CAGTGGCCTCACATGACAGAAGG - Intronic
1007278300 6:40691611-40691633 CAGAGGGGCCACATGAAAGATGG - Intergenic
1008224756 6:48901178-48901200 CAATGAGATCACATGGACGCAGG - Intergenic
1008800555 6:55363631-55363653 CAGTGAGATCACATGGACACAGG - Intronic
1009522779 6:64705774-64705796 CAATGAGATCACATGGACGCAGG + Intronic
1009731919 6:67619963-67619985 CAATGAGATCACATGGACAAAGG - Intergenic
1010137845 6:72575951-72575973 CAGTGAGATCACATGGACACAGG + Intergenic
1011190887 6:84727086-84727108 CAGTGAGAACACATGGACGCAGG + Intronic
1011403244 6:86987794-86987816 CAGTGTCCTCACATGGCAGAAGG + Intronic
1012040442 6:94198221-94198243 CAGTGAGATCACATGGACACAGG - Intergenic
1012279741 6:97314586-97314608 CAGAAAGATCATATGGAAGAAGG - Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1013470034 6:110455841-110455863 CAGTGTCCTCACATGGAAGAAGG - Intronic
1013877141 6:114845742-114845764 CAGTGAGATCACATGGACACAGG - Intergenic
1014522472 6:122461455-122461477 CAGTGAGATCACATGGACACAGG + Intronic
1015775205 6:136806969-136806991 CAGTGGTATCAAAAGGAAAAGGG - Intergenic
1018127021 6:160691644-160691666 CAGTGTCCTCACATGGCAGAAGG - Intergenic
1018149537 6:160925436-160925458 CAGTGTCCTCACATGGCAGAAGG + Intergenic
1018284534 6:162223052-162223074 CAATGAGATCACATGGACGCAGG - Intronic
1018442458 6:163825611-163825633 CAGTGGCATCAAATAGAAGATGG + Intergenic
1019605678 7:1909050-1909072 CAGTGGGAACACAGGGCAGGAGG + Intronic
1020767535 7:12342876-12342898 CAATGGGATCACATGGACACAGG - Intronic
1020885236 7:13812077-13812099 CAGTGAGATCACATGGACACAGG + Intergenic
1020894181 7:13918671-13918693 CAATGAGATCACATGGACGCAGG + Intronic
1021938134 7:25651711-25651733 CAGTGAGATCACATGGACACAGG - Intergenic
1022959119 7:35409448-35409470 CAGTGTGATGACATGGGAGAGGG - Intergenic
1024325408 7:48105711-48105733 CTGTGTGCTCACATGGCAGAAGG + Intronic
1024964650 7:55013200-55013222 CAGTGCCCTCACATGGCAGAAGG - Intergenic
1025248498 7:57335976-57335998 TAGTGGGACCACATGGAATGGGG + Intergenic
1025315563 7:58022241-58022263 CAGTGAGATCACATGGACACAGG - Intergenic
1025599067 7:62971956-62971978 CAGTGAGATCACATGGACACAGG + Intergenic
1027448073 7:78297776-78297798 CAGTGAGATCACATGGACACAGG + Intronic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1027840131 7:83299160-83299182 CAGTGAGATCACATGGACACAGG + Intergenic
1028119892 7:87045555-87045577 CAGTGAGATCACATGGACACAGG + Intronic
1028507775 7:91589085-91589107 CAATGAGATCACATGGACAAAGG + Intergenic
1028533514 7:91864909-91864931 CAGTGGGAACACATGGACACAGG + Intronic
1029512671 7:101006178-101006200 CCATGGGATCACCTGGAACAGGG - Intronic
1030359765 7:108582579-108582601 CAGTGTCATAACATGGCAGAAGG + Intergenic
1031186350 7:118484499-118484521 CAGTGAGATCACATGGACACAGG - Intergenic
1031506221 7:122587309-122587331 CAGTGAGATCACATGGACGTAGG - Intronic
1033366521 7:140676200-140676222 CTGTGTCATCACATGGTAGAAGG + Intronic
1033503850 7:141980280-141980302 CAGTGAGATCACATGGACACAGG - Intronic
1034375039 7:150634839-150634861 CAATGAGAACACATGGAACAGGG - Intergenic
1034458065 7:151182246-151182268 CAGTGGGCACACATGGAAATGGG + Intronic
1035572766 8:684549-684571 CAGTGGTACCACAGAGAAGAGGG + Intronic
1035858957 8:3007718-3007740 CAGTGAGATCACATGGACACAGG + Intronic
1035892875 8:3364714-3364736 CTGTGACATCACATGGCAGAAGG - Intronic
1037408486 8:18568900-18568922 CAGTGAGATCACATGGACACAGG - Intronic
1037779160 8:21855988-21856010 CAGAGGGATCACCTGGAGGGAGG - Intergenic
1037821593 8:22137726-22137748 CAGTGGGAGCACAGGCAGGAGGG - Intergenic
1039398110 8:37244663-37244685 CTGTGGAATCACATGGTAAAGGG + Intergenic
1039594825 8:38782214-38782236 CAGTGAGATCACATGGACACAGG - Intronic
1040809550 8:51436491-51436513 CAGTGGGATCACATGGAAGAAGG - Intronic
1041257623 8:55992785-55992807 CTGTGTCCTCACATGGAAGAAGG + Intronic
1041716933 8:60941015-60941037 CTGTGTTCTCACATGGAAGAAGG + Intergenic
1041999374 8:64103595-64103617 CAATGTGATCAACTGGAAGAAGG + Intergenic
1043159316 8:76826160-76826182 GAGTGGGATCAAAAGGGAGAGGG + Intronic
1043338283 8:79204330-79204352 CAGTGGGATCAAAATGAAGCAGG + Intergenic
1043571733 8:81611381-81611403 CAGTGAGAACACATGGACAAGGG + Intergenic
1044131460 8:88528910-88528932 CAGTGAGAACACATGGACGCTGG + Intergenic
1044510849 8:93076536-93076558 CTGTGGGATCCCATAGGAGAGGG - Intergenic
1045201875 8:99991487-99991509 CAATTCGATCAAATGGAAGAAGG + Intronic
1046346028 8:112928481-112928503 CAGTGAGATCACATGGACACAGG - Intronic
1046381100 8:113452317-113452339 CAGTGAGATCACATGGACACAGG + Intergenic
1046398610 8:113674810-113674832 CAGTGAGATCACATGGACACAGG + Intergenic
1046449885 8:114374776-114374798 CAGAGTGATCACATGGCAAAAGG - Intergenic
1046493568 8:114984750-114984772 CAATGGGAACACATGGACGCAGG - Intergenic
1047527019 8:125642167-125642189 CTGTGGGAGCACAAGGAAGGAGG - Intergenic
1047805095 8:128351061-128351083 CAGTGAGATCACATGGACACAGG - Intergenic
1048075283 8:131063174-131063196 CAGTGAGATCACATGGACACAGG - Intergenic
1048077034 8:131082770-131082792 CAGTGAGATCACATGGACACAGG + Intergenic
1049247801 8:141571973-141571995 TATTGGGACCACATGGCAGAGGG + Intergenic
1050744787 9:8862866-8862888 CAGTGAGATCACATGGACACAGG + Intronic
1051005640 9:12339817-12339839 CAGTGAGATCACATGGACACAGG + Intergenic
1052143512 9:25019782-25019804 CAGTGAGATCACATGGACAGAGG - Intergenic
1052161152 9:25261591-25261613 CAGTGTTATCAAATGGAGGATGG - Intergenic
1052288565 9:26816724-26816746 AAGTGTGATAACATGGATGAAGG + Intergenic
1052398142 9:27966517-27966539 CAGTGGGAACACATGGACACAGG + Intronic
1052419424 9:28223332-28223354 CTGTGGTCTCACATGGAAGAAGG + Intronic
1052430036 9:28353950-28353972 CAGTGAGATCACATGGACACAGG + Intronic
1052887084 9:33660159-33660181 CTCTGGGACCACATGGAAGTAGG - Intergenic
1052900965 9:33794809-33794831 AAGTGGCTTCACATTGAAGAAGG + Intronic
1053044248 9:34900837-34900859 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1053801662 9:41767722-41767744 CTGTGTCATCACATGGCAGAAGG - Intergenic
1054143542 9:61547104-61547126 CTGTGTCATCACATGGCAGAAGG + Intergenic
1054190094 9:61979876-61979898 CTGTGTCATCACATGGCAGAAGG - Intergenic
1054463315 9:65478439-65478461 CTGTGTCATCACATGGCAGAAGG + Intergenic
1054648421 9:67608715-67608737 CTGTGTCATCACATGGCAGAAGG + Intergenic
1054760145 9:68997555-68997577 CAATGTGATCACCTGGCAGAAGG - Intronic
1055669537 9:78588955-78588977 CTGTGTCATCACATGGCAGAAGG - Intergenic
1056721065 9:89072434-89072456 TAATGGGATAAAATGGAAGATGG - Intronic
1057698850 9:97348566-97348588 TAGTGGGATCAGATGGGAGGTGG + Intronic
1057861393 9:98643677-98643699 CAGTTGGCTCACATGGATTAAGG - Intronic
1058541263 9:106014874-106014896 CAGTGTCCTCACATGGTAGAAGG + Intergenic
1058557136 9:106181812-106181834 CAATGAGATCACATGGAAACAGG - Intergenic
1059712035 9:116877551-116877573 CAGTAAGATCATATGGCAGAGGG + Intronic
1203344901 Un_KI270442v1:27001-27023 AAGTGGAATCAAATGGAATACGG + Intergenic
1186260301 X:7770799-7770821 AAATGGCATCAGATGGAAGATGG - Intergenic
1188185485 X:27109180-27109202 CAGTGAGATCACATGGACACAGG - Intergenic
1189582771 X:42425053-42425075 CAGTGAGATCACATGGACACAGG - Intergenic
1189843559 X:45108916-45108938 CAGTGAGATCACATGGACACAGG + Intronic
1190129994 X:47739184-47739206 CAATGGGAACACATGGACGCAGG + Intergenic
1190684644 X:52860810-52860832 CAGTGAGAACACATGGAAACAGG + Intergenic
1191094591 X:56661143-56661165 TAGTTGGATCCCATGGGAGATGG + Intergenic
1191777080 X:64826459-64826481 CAATGAGAACACATGGAAAAAGG + Intergenic
1191789495 X:64954115-64954137 CAATGAGATCACATGGACGCAGG + Intronic
1193179048 X:78431800-78431822 CAGTGGGATCACATTTGGGATGG - Intergenic
1193823402 X:86194464-86194486 CAGAGGGAAGACATGGAAGCTGG + Intronic
1195297097 X:103489840-103489862 CAGTGAGATCACATGGACACAGG - Intergenic
1195619015 X:106934794-106934816 CAGTGAGATCACATGGACACAGG + Intronic
1195833041 X:109081602-109081624 AAGTTGGATCTCATGGAAGTAGG + Intergenic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1196283964 X:113857956-113857978 CAGTGGGAACACATGGACACAGG - Intergenic
1196286462 X:113886707-113886729 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1196508911 X:116481968-116481990 CAATGGGAACACATGGAAACAGG + Intergenic
1197675407 X:129324540-129324562 CACTAGGATCACATGGAATGAGG + Intergenic
1197890207 X:131262787-131262809 CAATGGGCTCATAGGGAAGAAGG - Intergenic
1199280343 X:145993391-145993413 CAGGGGGAGAACATGCAAGATGG - Intergenic
1200510654 Y:4074808-4074830 CAGTGAGAACACATGGATGCAGG - Intergenic
1201622053 Y:15970202-15970224 CATCAGGATCACATGGGAGAAGG - Intergenic
1201717387 Y:17061115-17061137 CAGTGAGATCACATGGACACAGG - Intergenic
1202032814 Y:20595571-20595593 CAGTGAGATCACATGGACACAGG + Intergenic
1202072439 Y:21006108-21006130 CAGTGAGATCACATGGACACAGG - Intergenic