ID: 1040810202

View in Genome Browser
Species Human (GRCh38)
Location 8:51444107-51444129
Sequence ATGCTGTTATTGATGAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040810202_1040810204 22 Left 1040810202 8:51444107-51444129 CCCTGTTTCATCAATAACAGCAT 0: 1
1: 0
2: 0
3: 19
4: 231
Right 1040810204 8:51444152-51444174 TTACTTTCTGCTACAAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040810202 Original CRISPR ATGCTGTTATTGATGAAACA GGG (reversed) Intronic
903430709 1:23297185-23297207 TTGTTTTTATTGATGTAACATGG - Intergenic
904111941 1:28133099-28133121 TTGTTGTTGTTGTTGAAACAGGG + Intergenic
906428568 1:45735395-45735417 ATGTTGTTTTTGTAGAAACAAGG + Intronic
907552338 1:55314912-55314934 ATGCTGGTTTTGATGACATAAGG - Intergenic
907746857 1:57222367-57222389 GTGTTGTTATAGAGGAAACATGG + Intronic
908693626 1:66811297-66811319 ATGCTTTTATAGAAGAAAAATGG + Intergenic
909566213 1:77056146-77056168 ATGCTGTTTCTGGTGCAACATGG - Intronic
910617138 1:89210974-89210996 AAACAGTTATTTATGAAACAAGG + Intergenic
910658765 1:89647239-89647261 ATGCTATTATGTATCAAACATGG + Intronic
910905945 1:92178657-92178679 TTGTTGTTATTGTTGAGACAGGG + Intronic
911780523 1:101870290-101870312 ATGATGTTATTGATGAATTATGG - Intronic
912956723 1:114159143-114159165 ATGGTGTCATTGATAAAATACGG + Intergenic
917184222 1:172334668-172334690 AAGCAGTTACTGCTGAAACATGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918294469 1:183143137-183143159 CTGCTGGTATCGATGAGACAGGG - Exonic
919528705 1:198687522-198687544 ATGCCTTTATATATGAAACAAGG - Intronic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
924380103 1:243455057-243455079 ATGCTGTAATTCATAAGACAAGG + Intronic
1063004611 10:1956986-1957008 ATGCTCATATTGATGATAGACGG + Intergenic
1064757397 10:18583652-18583674 ATTCTCTATTTGATGAAACATGG - Intronic
1065095042 10:22272083-22272105 ATGCTCTTTTTATTGAAACAGGG + Intergenic
1065202394 10:23325821-23325843 ATGCTGTAATAAATGAAAAAAGG + Intronic
1065653329 10:27917524-27917546 AGGCAGATATTAATGAAACAGGG + Intronic
1068479036 10:57565280-57565302 ATTCTGTCATTTGTGAAACATGG - Intergenic
1068614029 10:59091884-59091906 GTGCTGTTATTGTTGGAGCAAGG + Intergenic
1070913580 10:80138401-80138423 ATGGTGTTATTGCTGAATCTGGG - Intronic
1080327063 11:31087891-31087913 GTTCTGTTAATTATGAAACAGGG + Intronic
1082631086 11:55543074-55543096 ATGCTCTTATTGCTTACACAAGG + Intergenic
1083247351 11:61439491-61439513 ATTCTGTTATCGATGAAAACTGG + Intronic
1084361947 11:68674382-68674404 ATTCTGTTATTCATGCATCACGG + Intergenic
1085058309 11:73421336-73421358 GTGCTGTTTTTGTTGAACCAAGG + Intronic
1085419264 11:76341547-76341569 CTGCTCTTATTGATGTCACACGG + Intergenic
1087517926 11:99189141-99189163 ATCCTGTTATTTGTGTAACATGG - Intronic
1087824823 11:102753403-102753425 ATTTTGATAATGATGAAACAAGG - Intergenic
1088762626 11:112947008-112947030 ATGCAGTTCATGATGAAATAGGG - Intergenic
1089521100 11:119064186-119064208 ATGCGGTTATTGACGAAAACTGG + Intergenic
1089875700 11:121719706-121719728 ATGCTGTCATTGGAGAACCAGGG - Intergenic
1092567305 12:9681369-9681391 TTGCTATTTTTCATGAAACAAGG - Intronic
1094107473 12:26829868-26829890 ATGCTGCTATTGGTGAAACCTGG - Intronic
1097363336 12:58682263-58682285 TTGATGTTATTGAGAAAACAAGG + Intronic
1098075396 12:66724446-66724468 ATGATGTATTTGATGAAATAAGG - Intronic
1098582705 12:72120024-72120046 ATGCTATTATTGATAAAGTAAGG + Intronic
1099095058 12:78364988-78365010 ATGCTGTTATTAAAGATAAAAGG - Intergenic
1100460506 12:94794770-94794792 ATGCTGTTAATAATGACACAAGG + Intergenic
1101195550 12:102378249-102378271 ATACTGTGATTGAGGAGACAAGG - Intergenic
1102014735 12:109640477-109640499 ATGCAGTTAGTGACTAAACAGGG + Intergenic
1104731955 12:131111803-131111825 ATTCTGTGTTTGATGAGACAGGG + Intronic
1108383569 13:49877526-49877548 AAAATGTTATTTATGAAACAAGG + Intergenic
1108422867 13:50268359-50268381 AAGCTGTTATTAATAGAACATGG - Intronic
1108556874 13:51602063-51602085 ATGCATTTATTGTTGGAACAGGG + Intronic
1109314866 13:60738641-60738663 ATGCGCTTATTGAGAAAACAGGG - Intergenic
1109520334 13:63502088-63502110 ATGCAGTTATTGATAAACCCTGG + Intergenic
1109623468 13:64941802-64941824 TTGCTGTTGTTGTTGAGACAGGG - Intergenic
1110368473 13:74714632-74714654 ATGCTGTTATTCATGACTCTAGG - Intergenic
1110830767 13:80028252-80028274 ATGATGTAATTAATGGAACATGG - Intergenic
1111080776 13:83304328-83304350 ATACTTTTTTTGAAGAAACATGG + Intergenic
1111918673 13:94388003-94388025 ATGCAGTTATTGTTGATCCAGGG + Intronic
1113355431 13:109575513-109575535 ATGCAGTTAGTGAATAAACAGGG + Intergenic
1114860788 14:26518415-26518437 AAGGTGTTATTGATAAAAGAGGG - Intronic
1115161435 14:30400103-30400125 ATGCTGTCAATGATGTAGCATGG - Intergenic
1116757162 14:48962357-48962379 ATGCTGTTATATATCATACACGG + Intergenic
1117648028 14:57872948-57872970 ATGCTGTGATTGGTGGAGCAGGG - Intronic
1118195322 14:63620269-63620291 ATCCTGTCATTTGTGAAACAGGG + Intronic
1119053939 14:71399409-71399431 CTGCTGTTGTTTTTGAAACAGGG + Intronic
1120853232 14:89189471-89189493 AGCCTCTTACTGATGAAACACGG - Intronic
1126499632 15:49330952-49330974 TTGTTGTTGTTGTTGAAACAGGG - Intronic
1126851109 15:52797860-52797882 ATGATGTTAATGATGGAAAAAGG + Intergenic
1128193782 15:65731470-65731492 TTGCAGTTATTAATGAAAAAAGG - Intronic
1128669026 15:69560484-69560506 TTGCTGTTATTTTTGAGACAGGG - Intergenic
1129328015 15:74812328-74812350 ATGCTTTTGTTGAGGAAACCAGG + Intergenic
1133482360 16:6183563-6183585 ATGCTGTTATATATGAGAGAGGG + Intronic
1134265604 16:12690201-12690223 ATGGTGTCTTTCATGAAACAGGG - Intronic
1134795005 16:17027076-17027098 ATGCTATTATTCATGCAACCTGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138646554 16:58429891-58429913 TTGTTGTTGTTGTTGAAACAGGG + Intergenic
1138716322 16:59027321-59027343 CTTGTGTTATTGCTGAAACATGG - Intergenic
1140352144 16:74272416-74272438 TTGTTGTTATTGTTGAGACAGGG - Intergenic
1140423196 16:74837703-74837725 ATGTTGTTATTTTTGAGACAGGG - Intergenic
1140539408 16:75742406-75742428 AAAATGTTATTTATGAAACAAGG + Intronic
1140962904 16:79934012-79934034 ATGCAGGTATTTATCAAACAGGG - Intergenic
1141309948 16:82903812-82903834 GTGCTCTTATTTACGAAACATGG - Intronic
1146776624 17:35624353-35624375 GTGCTGTTCTTGGTGAATCAAGG + Intronic
1147549369 17:41428609-41428631 ATGATGGTGTTGATGAAACCTGG + Intergenic
1148982671 17:51592217-51592239 ATGCTGGTATTGAAGATAAAAGG + Intergenic
1150903570 17:69312150-69312172 ATGCTATTAATGATTAAACAAGG - Intronic
1158887513 18:61842415-61842437 CTGCTGTCATTGCTGGAACAAGG + Intronic
1159028106 18:63205200-63205222 AGGCTGTTGTTGATGAAGGATGG - Intronic
1161868317 19:6850897-6850919 ATGCTCTTAATGATGAACAATGG + Intronic
1164453351 19:28385839-28385861 CTGCTGTTCTTGAATAAACATGG - Intergenic
1164954796 19:32373024-32373046 AAGGTGTTATTTATGAAGCAGGG - Intronic
1167198656 19:48048751-48048773 AAGCTGTTATTGCTGGATCAGGG - Intronic
925417651 2:3682443-3682465 ATTCTGTTTTTTATTAAACATGG + Intronic
925600049 2:5598903-5598925 CTGCTTTTGTTGGTGAAACAAGG + Intergenic
928504994 2:31941911-31941933 ATTCTGATATTGATTAAAAACGG + Intronic
930187180 2:48421722-48421744 ATAATGTTTTTGATGAAATAAGG - Intergenic
931390641 2:61840532-61840554 ATGATGTCATTAATGAGACAGGG + Exonic
934559488 2:95305400-95305422 ATGCTGTCATTGGGGAAACCAGG - Intronic
935847692 2:107184706-107184728 ATCCTGTTATTGGTGATACAGGG - Intergenic
936662725 2:114560180-114560202 AAGCTATTATTGGTGAACCATGG + Intronic
937330876 2:121028471-121028493 ATGATATTATTGATCTAACAAGG + Intergenic
937601697 2:123744281-123744303 TTGCTGTTGTTGTTGAGACAGGG - Intergenic
937680416 2:124638260-124638282 ATACTGACATTGCTGAAACAAGG - Intronic
938265985 2:129928640-129928662 ATGGTGTTATTGCTGAATCTGGG + Intergenic
939325794 2:140686560-140686582 ATACTTTTATTGATGAAAATAGG + Intronic
939441254 2:142253138-142253160 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
939814325 2:146875080-146875102 AGGCTGTTGTTCATGAAACATGG - Intergenic
940859303 2:158755737-158755759 TTTCTTTTATTGAAGAAACAAGG - Intergenic
941509509 2:166388136-166388158 ATGTTGTCATTTATGAAAAATGG + Intergenic
944083981 2:195822591-195822613 TTGCTGGGATTGATTAAACAGGG - Intronic
946390547 2:219413574-219413596 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
946668654 2:222078195-222078217 AAGCTGTAATTGTTGAGACAGGG + Intergenic
946954998 2:224920077-224920099 TTGCTGTTGTTGTTGAGACAGGG + Intronic
1171296800 20:24024133-24024155 ATGCAGTGATTGAAGAAATATGG + Intergenic
1172852835 20:37978924-37978946 TTGCTGTTGTTGTTGAAACAGGG - Intergenic
1172866664 20:38105082-38105104 ATGCTGGTATAGATGGAACGGGG + Intronic
1173038465 20:39435692-39435714 ATGCTATCATTGAGGAAACTGGG - Intergenic
1175458074 20:59130172-59130194 TTGCTGTTATTAAAGAGACAGGG + Intergenic
1175884778 20:62283517-62283539 GGGTTGTTATTGATGAAAAAAGG + Intronic
1178451555 21:32705978-32706000 TTGCTGTTGTTGTTGAGACAGGG - Intronic
1183799277 22:40148191-40148213 GTACTGCTATTGATGAGACATGG + Intronic
951295958 3:20934824-20934846 ATGCTGGTATTGAAGAAACGTGG + Intergenic
951472465 3:23070994-23071016 ATGCTTTTATTGCAGAGACAGGG - Intergenic
953802602 3:46037285-46037307 AAAATGTTATTTATGAAACAAGG + Intergenic
955830722 3:63000355-63000377 ATTCTGGTTTTGATGTAACAGGG + Intergenic
956008589 3:64806439-64806461 ATGATGATGATGATGAAACATGG - Intergenic
956175383 3:66468361-66468383 ATTCTGTTAATGTTGAAAAATGG - Intronic
957695530 3:83634052-83634074 TTTCTGTTATTCATGAGACAGGG - Intergenic
957697439 3:83658911-83658933 TTGCTGTTGTTGATGAGACAGGG + Intergenic
959797375 3:110446325-110446347 ATGCAGTTATTGCTTAAGCACGG - Intergenic
960245440 3:115394976-115394998 ATGGTGTTATGGAGAAAACACGG + Intergenic
960373425 3:116868971-116868993 AGTCTGTTCTTGATGATACATGG + Intronic
961025259 3:123550134-123550156 TTGTTGTTGTTGTTGAAACAGGG - Intronic
961597908 3:128033827-128033849 AAGCTGTTTTTGATGAACCGTGG - Intergenic
962083809 3:132169311-132169333 ATGCTGCAATTCATGAATCAAGG - Intronic
963208367 3:142659902-142659924 AGGCTTTAATTGATGAAAGAAGG - Intronic
964530546 3:157663160-157663182 ATGCATTTATTTATGAAACAGGG - Intronic
964670065 3:159215156-159215178 ATGCTGGGCTTGATGAAAAATGG + Intronic
965436949 3:168664057-168664079 CTGCTGTTCTTGATGAGACTTGG + Intergenic
965754801 3:172014851-172014873 AGTTTGTTATTGATGAAACAAGG + Intergenic
966174851 3:177126969-177126991 ATGTTGTTTTTGCTGAAACTGGG - Intronic
969960104 4:10936050-10936072 ATTCAGTTAGTGATTAAACACGG - Intergenic
970438354 4:16057375-16057397 ATGCTGTCACTGATGAAATTAGG - Intronic
970764358 4:19529582-19529604 ATCCTGTTATTTGTGCAACATGG + Intergenic
971092205 4:23359101-23359123 GTGTTGTTATTGCTGAACCAGGG + Intergenic
972060014 4:34858045-34858067 ATGCTGTAATAGATTAAATATGG - Intergenic
974297031 4:60013439-60013461 ATGCTGTTAATTAGGAAACCAGG + Intergenic
974727689 4:65816956-65816978 CTGCAGATATTGATGTAACATGG + Intergenic
976945384 4:90759554-90759576 ATGTTGTTATTGTTGCACCATGG + Intronic
977262269 4:94812214-94812236 ATACTGTTATAGAAGAAGCAGGG + Intronic
980312647 4:131153575-131153597 TTGTTGTTATTGTTGAAAAAGGG - Intergenic
980483338 4:133419211-133419233 ATGCTGTTATAGATGTAAAGAGG + Intergenic
981078492 4:140615007-140615029 TTGCTGTTATTAATTAAATAGGG + Intergenic
982460636 4:155665630-155665652 ACACTGTTATTCAAGAAACAAGG - Intergenic
982477023 4:155866263-155866285 ATACTGTTATTGATGAAAATTGG - Exonic
984108217 4:175576782-175576804 AAGCTGTTACTGAGGAAACATGG - Intergenic
985810234 5:2077946-2077968 ATGCTGTGATTGATGAAATTTGG + Intergenic
988035418 5:25822210-25822232 ATGCTTACATTGATGGAACATGG - Intergenic
988050140 5:26017147-26017169 ATGTTGGTATACATGAAACATGG - Intergenic
988129409 5:27083026-27083048 ATTCTGTTAGTCATGAAACTAGG - Intronic
990687756 5:58326225-58326247 ATGTTGATATTTCTGAAACATGG - Intergenic
992472098 5:77068002-77068024 AAGCTGTGACTGAAGAAACATGG + Intergenic
993556943 5:89351507-89351529 ATGGTGTTAGTAATCAAACATGG + Intergenic
993589289 5:89774661-89774683 CTGCTGATATTTTTGAAACAAGG + Intergenic
993658899 5:90606074-90606096 ATGCTTTTAATGATCATACAAGG - Intronic
994181711 5:96774626-96774648 ATGCCTTGATTAATGAAACATGG - Exonic
995053361 5:107731561-107731583 ATGATGTTTCTGTTGAAACAGGG + Intergenic
998761547 5:145437810-145437832 ATGCTGCTATTAAAGAAATATGG + Intergenic
999003624 5:147951667-147951689 ATGCTGTTATTGTGACAACAAGG - Intergenic
999633071 5:153591708-153591730 ATACTGTTATTTAAGAAGCAAGG + Intronic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
1003665800 6:8110145-8110167 TTGCTGTTGTTGTTGAGACAGGG - Intergenic
1005196125 6:23286398-23286420 ATGCTGGATTTGAGGAAACAAGG - Intergenic
1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG + Intronic
1008837047 6:55846350-55846372 TTGGTGTTATTGAAGACACATGG + Intronic
1008988643 6:57577045-57577067 ATGCAGTTTTTGGGGAAACATGG - Intronic
1009177245 6:60475604-60475626 ATGCAGTTTTTGGGGAAACATGG - Intergenic
1009449530 6:63785060-63785082 ATGCTGATATTGCTGACCCAGGG + Intronic
1009502526 6:64433250-64433272 ATTTTGTTATTGTTGAAATATGG - Intronic
1009897702 6:69773811-69773833 ATGCTAGTGTTGATGAAAAATGG - Intronic
1010939152 6:81895610-81895632 ATTCTGTTATTAGTGAATCAGGG + Intergenic
1011484542 6:87828539-87828561 AGGCAGTTAGTGAGGAAACAGGG - Intergenic
1015073815 6:129130545-129130567 ATGCTGATAGTGGTGAGACATGG + Intronic
1015590280 6:134816484-134816506 ATGATGTTAATGATGACTCATGG + Intergenic
1016070898 6:139737761-139737783 GTTCTGTTAGTGAAGAAACATGG + Intergenic
1016872636 6:148834018-148834040 ATGCTGTTATTGAAACAATATGG + Intronic
1020743001 7:12045812-12045834 ATGCTATTATTTATGAAGGAAGG - Intergenic
1021337627 7:19422843-19422865 ATGTTATAATTGATGAAACTGGG + Intergenic
1022198215 7:28090378-28090400 AGGCAGTTATTGAAGAAACTGGG - Intronic
1022407289 7:30102617-30102639 ATGCTGATATGGATGAATCTTGG + Intronic
1024537380 7:50449589-50449611 ATTCTGTTCTTGATGCAAAACGG + Exonic
1027642427 7:80753687-80753709 TTACTGTTGTGGATGAAACATGG - Intronic
1027979056 7:85193831-85193853 TTGTTGTTATTGTTGAAAGATGG - Intergenic
1029412766 7:100426551-100426573 ATACTGTTATTAATGCAAAAAGG - Intronic
1030672702 7:112354474-112354496 ATCCTGTTATTGTGGCAACATGG - Intergenic
1030845722 7:114407907-114407929 AAGCTGTCCTTGATGAAACATGG - Intronic
1030971583 7:116063751-116063773 ATCCTGTTATTGTAAAAACATGG - Intronic
1031308146 7:120160088-120160110 ATACTGTAATTGAGGACACATGG - Intergenic
1031841715 7:126749881-126749903 TTGCTGTTAGTGATGCAAAATGG + Intronic
1031894846 7:127337067-127337089 TTGTTGTTATTGTTGAGACAGGG + Intergenic
1031910863 7:127515541-127515563 ATGCTGCATTTGATGAAATAGGG - Intergenic
1033387994 7:140897693-140897715 ATCCTGGCATGGATGAAACATGG - Intronic
1033971956 7:147052450-147052472 ATTCTTTTATTGGTGGAACAGGG + Intronic
1033974081 7:147078473-147078495 AAGCTGTTACTGATTAGACAGGG + Intronic
1034463440 7:151211240-151211262 ATGCTGTGATTAAAGAAACCTGG + Intronic
1036697884 8:10990596-10990618 TTGCTGTTATTGCTGAGACAGGG + Intronic
1037645322 8:20787596-20787618 ATGGTGTGCTTGATGATACAGGG + Intergenic
1040618130 8:49060897-49060919 ATGATGTAATTGATGAAGAAAGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041806509 8:61855398-61855420 ATGTTATTATTTTTGAAACAGGG + Intergenic
1042309142 8:67363165-67363187 ATGCTATTATTTATGCAAAATGG + Intergenic
1043052323 8:75399151-75399173 ATACTGTAATTGATAGAACAAGG + Intergenic
1043254325 8:78114726-78114748 AAGCTGTGATTGATCAAAGATGG - Intergenic
1043341124 8:79240952-79240974 ATGGTGTTATTTATGAAAATGGG + Intergenic
1043386636 8:79755484-79755506 TTTTTGTTATGGATGAAACATGG - Intergenic
1044080727 8:87879718-87879740 ATGCTTTCTTTGGTGAAACAGGG + Intergenic
1045906366 8:107350169-107350191 TTGCTGTCATTTAGGAAACATGG - Intronic
1047195829 8:122720695-122720717 TTGCTGTTGTTGTTGAGACAGGG - Intergenic
1047676707 8:127210460-127210482 CAGATGTTATTGATGAATCATGG + Intergenic
1048529224 8:135232593-135232615 ATGGTGTTATGGAAGCAACAAGG + Intergenic
1048726403 8:137390319-137390341 TTGCTGTTGTTGTTGAGACAGGG + Intergenic
1048900781 8:139035555-139035577 ATGCTTTTGCTGATAAAACAAGG + Intergenic
1050355218 9:4776438-4776460 ATGCTGCTGTTGTTGAGACAGGG - Intergenic
1051351442 9:16201508-16201530 ATGTTGTTCCTGATGAAAAAAGG - Intergenic
1051957235 9:22711239-22711261 ATTCTGTTCTGGAGGAAACAAGG - Intergenic
1052444354 9:28541111-28541133 TTGCTGATATTGATGAAATGTGG + Intronic
1054824339 9:69557121-69557143 ATACTATTATTCATAAAACATGG + Intronic
1054894412 9:70292034-70292056 AAGCTGTTATTCAAGAAAAATGG - Intronic
1055172112 9:73271398-73271420 ATGCTTTTGTTGTTGAAACAAGG + Intergenic
1056109227 9:83378069-83378091 ATGCTGTAAGTGAGGAAACCAGG - Intronic
1056242096 9:84657903-84657925 AAGCTGATATTAAAGAAACAAGG + Intergenic
1056854286 9:90111920-90111942 AAGATGTTACTCATGAAACAAGG - Intergenic
1056987846 9:91380677-91380699 ATGCTGTTATTCAAAAAAGAAGG + Intergenic
1058412127 9:104745736-104745758 ATGCAGTTAATGATGAGACTAGG + Intergenic
1059461585 9:114434223-114434245 CTGCTGTCATCTATGAAACACGG - Intronic
1186227405 X:7414629-7414651 ATGCTTGTATAAATGAAACATGG + Intergenic
1187566501 X:20454718-20454740 ATGCTGTTGTTGCTGGACCATGG + Intergenic
1188256498 X:27967379-27967401 ATGCTGTTTTACATTAAACAGGG + Intergenic
1189088569 X:38053211-38053233 ATGCTGATACTGCTGGAACAAGG + Intronic
1192120022 X:68446779-68446801 TTGCTGTTGTTGTTGAGACAGGG + Intergenic
1193032768 X:76917486-76917508 TGGCTGCTATTGATGATACAAGG - Intergenic
1193509854 X:82385352-82385374 ATTTTTTTAATGATGAAACATGG - Intergenic
1193835029 X:86332264-86332286 ACACTGTTATTGAAGAATCAAGG - Intronic
1194008913 X:88534225-88534247 AAAGTGTTATTTATGAAACATGG - Intergenic
1195005091 X:100678067-100678089 ATGCTGTTAATAATGAAAGAAGG - Intronic
1195405424 X:104507900-104507922 ATGCTGTTACTGATGACACTAGG - Intergenic
1195478552 X:105316470-105316492 AAACAGTTATTGATGAAACCAGG + Intronic
1196201041 X:112886275-112886297 ATGCTGTTTTTGCTGACTCAAGG - Intergenic
1196652963 X:118187565-118187587 TTGTTGTTGTTGTTGAAACAGGG - Intergenic
1198113272 X:133521632-133521654 ATGCTGTTATTCTTGGAAAACGG + Intergenic
1199895812 X:152127246-152127268 ATGCTCTGATTGAAGAAAAAGGG - Intergenic
1200945793 Y:8835667-8835689 AAGCTTATATTGATAAAACATGG - Intergenic