ID: 1040810204

View in Genome Browser
Species Human (GRCh38)
Location 8:51444152-51444174
Sequence TTACTTTCTGCTACAAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040810201_1040810204 23 Left 1040810201 8:51444106-51444128 CCCCTGTTTCATCAATAACAGCA 0: 1
1: 0
2: 0
3: 14
4: 225
Right 1040810204 8:51444152-51444174 TTACTTTCTGCTACAAACAAAGG No data
1040810200_1040810204 24 Left 1040810200 8:51444105-51444127 CCCCCTGTTTCATCAATAACAGC 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1040810204 8:51444152-51444174 TTACTTTCTGCTACAAACAAAGG No data
1040810203_1040810204 21 Left 1040810203 8:51444108-51444130 CCTGTTTCATCAATAACAGCATC 0: 1
1: 0
2: 1
3: 19
4: 196
Right 1040810204 8:51444152-51444174 TTACTTTCTGCTACAAACAAAGG No data
1040810202_1040810204 22 Left 1040810202 8:51444107-51444129 CCCTGTTTCATCAATAACAGCAT 0: 1
1: 0
2: 0
3: 19
4: 231
Right 1040810204 8:51444152-51444174 TTACTTTCTGCTACAAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040810204 Original CRISPR TTACTTTCTGCTACAAACAA AGG Intronic
No off target data available for this crispr