ID: 1040816486

View in Genome Browser
Species Human (GRCh38)
Location 8:51513234-51513256
Sequence TGCAAGTGCACAGCCTCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 170}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040816486_1040816494 21 Left 1040816486 8:51513234-51513256 CCAGATGAGGCTGTGCACTTGCA 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1040816494 8:51513278-51513300 CTCTGAGGATGGAAGCAGTGAGG No data
1040816486_1040816495 26 Left 1040816486 8:51513234-51513256 CCAGATGAGGCTGTGCACTTGCA 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1040816495 8:51513283-51513305 AGGATGGAAGCAGTGAGGAAAGG No data
1040816486_1040816493 10 Left 1040816486 8:51513234-51513256 CCAGATGAGGCTGTGCACTTGCA 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1040816493 8:51513267-51513289 CGGCATAAACACTCTGAGGATGG No data
1040816486_1040816491 6 Left 1040816486 8:51513234-51513256 CCAGATGAGGCTGTGCACTTGCA 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1040816491 8:51513263-51513285 GCCTCGGCATAAACACTCTGAGG No data
1040816486_1040816490 -10 Left 1040816486 8:51513234-51513256 CCAGATGAGGCTGTGCACTTGCA 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1040816490 8:51513247-51513269 TGCACTTGCAGGCAGGGCCTCGG No data
1040816486_1040816496 27 Left 1040816486 8:51513234-51513256 CCAGATGAGGCTGTGCACTTGCA 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1040816496 8:51513284-51513306 GGATGGAAGCAGTGAGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040816486 Original CRISPR TGCAAGTGCACAGCCTCATC TGG (reversed) Intronic
900267409 1:1765074-1765096 TTCAAGGGCACAGCTTCACCTGG + Intronic
901269177 1:7937448-7937470 TGCACGTGCCCAGCCTCCACTGG + Intronic
901292654 1:8136293-8136315 AGCAAGCCCACATCCTCATCAGG + Intergenic
901532507 1:9862449-9862471 TGCAAATTCCCAGGCTCATCTGG + Intronic
902800685 1:18827832-18827854 TGCAACTGGACAGTCCCATCTGG - Intergenic
904410010 1:30319618-30319640 TGCCAGGGCCCAGGCTCATCAGG + Intergenic
904743411 1:32695805-32695827 TCCACATGCAGAGCCTCATCTGG + Exonic
904843728 1:33392069-33392091 GGCAAGTACACAGCCACACCTGG - Intronic
905231964 1:36520211-36520233 TGCATGTGCACAGACACACCTGG - Intergenic
906128653 1:43442847-43442869 TGGAAGTGGAGACCCTCATCCGG + Exonic
909122305 1:71618562-71618584 TGCAACTAGACAGTCTCATCTGG - Intronic
910377833 1:86592969-86592991 TCCAAGTCCAAAGTCTCATCTGG + Intergenic
915228621 1:154429414-154429436 AGCAAGTGCACAGTCCCAGCTGG - Exonic
917408669 1:174736127-174736149 CCCAAGTCCAAAGCCTCATCTGG + Intronic
918530243 1:185512284-185512306 TCCAAGTCCAAAGTCTCATCTGG - Intergenic
920553630 1:206886651-206886673 TGCAACTAGACAGCCTCATCTGG - Intergenic
923664391 1:235986756-235986778 TAAAAGTGCACAGCCTTGTCTGG - Intronic
1063506129 10:6601399-6601421 TGCAACTAGACAGCCCCATCTGG + Intergenic
1064119890 10:12609488-12609510 TGCAACTGGACAGTCCCATCTGG + Intronic
1065268365 10:24000749-24000771 TTCAAGTACACAGCTTCCTCTGG + Intronic
1065795052 10:29298997-29299019 TGCAACTGGACAGTCCCATCTGG + Intronic
1067450503 10:46379335-46379357 TGCAAGTCCACAGGCCCATGGGG - Intronic
1067586740 10:47480416-47480438 TGCAAGTCCACAGGCCCATGGGG + Intronic
1068813075 10:61278436-61278458 TTAAAGTGAACAGCCTCATGTGG - Intergenic
1069928291 10:71866120-71866142 TGCAAATGGCCAGCATCATCTGG - Intergenic
1070569744 10:77631952-77631974 TGATAGAGCACAGCCTCATGGGG - Intronic
1070639564 10:78158071-78158093 GGGAAGTGCACAGACTCATGTGG - Intergenic
1071021606 10:81063876-81063898 AGCATGTGCATTGCCTCATCAGG - Intergenic
1075832704 10:125424816-125424838 GGCAAGGGCACAGACTCATTGGG - Intergenic
1076600155 10:131652052-131652074 TGCAGATTCAGAGCCTCATCTGG - Intergenic
1077139994 11:1020092-1020114 TCCAAGCCCACAGCCTCCTCGGG - Exonic
1077793142 11:5462644-5462666 AGCAAGGGCACTTCCTCATCAGG + Intronic
1079664814 11:23092236-23092258 TGCAACTACACAGTCCCATCTGG + Intergenic
1079916556 11:26375119-26375141 TGCAACTAAACAGTCTCATCTGG + Intronic
1080470244 11:32538515-32538537 TGCAACTAGACAGTCTCATCTGG + Intergenic
1082128040 11:48455407-48455429 TCCAAGTCCATAGTCTCATCTGG + Intergenic
1082249374 11:49962012-49962034 TCCAAGTCCATAGTCTCATCTGG - Intergenic
1084268716 11:68017991-68018013 AGCAAGCGCACAGCCACCTCGGG + Intronic
1084721128 11:70906331-70906353 AGCAAGTCCACAGCCTCTCCAGG - Intronic
1084757566 11:71249420-71249442 TGGACGCGCACAGCCTCTTCAGG - Intronic
1089689812 11:120180393-120180415 TGGGAATGCACAGCCTCTTCAGG + Intronic
1090711208 11:129387333-129387355 TGCAAGTGAACAGACTCCCCTGG - Intronic
1091208308 11:133835555-133835577 TGGAAGGGCACAGCCCCCTCAGG + Intergenic
1093371985 12:18376486-18376508 TCCAAGTCCAAAGTCTCATCTGG - Intronic
1097922270 12:65089193-65089215 TACAAATGAACAGCCTCATTGGG - Intronic
1099036184 12:77590160-77590182 TTTAAGTGCACAGCCTCTACTGG - Intergenic
1109123830 13:58491980-58492002 TTACAGTGCACAGCCTCTTCAGG + Intergenic
1109718440 13:66246716-66246738 TTCAAGTCCAAAGTCTCATCTGG - Intergenic
1110045104 13:70818263-70818285 TGGAAGTGGCCAGCCTCATTGGG + Intergenic
1117649466 14:57887753-57887775 AGCCTGTGCACAGCCTCTTCTGG + Intronic
1119203739 14:72778437-72778459 TGCAACTAGACAGTCTCATCTGG - Intronic
1122348405 14:101074221-101074243 TGCAGGTGCACAGCGACCTCAGG - Intergenic
1122607844 14:102959350-102959372 AGAAAGTGCTCAGCCTCTTCAGG - Intronic
1122857360 14:104566236-104566258 TGCCAGGGCAGAGCCCCATCAGG - Intronic
1124413494 15:29455937-29455959 TGCAACTGGACAGTTTCATCTGG - Intronic
1127063572 15:55213759-55213781 TGCAACTGGACAGTCCCATCTGG - Intronic
1129673980 15:77622452-77622474 TGCAAGTGCTCAGACTCACCTGG - Intronic
1130941377 15:88512237-88512259 TGTAATTGCACATCCTCATGTGG - Intronic
1131024183 15:89125756-89125778 TGCAAGGGGCCAGCCACATCAGG + Intronic
1133950182 16:10385191-10385213 TCCAAGTGCACAGCCACCTAAGG + Intronic
1136104660 16:28021243-28021265 TGCAAGTACACAGACTTATCAGG + Intronic
1136663153 16:31783300-31783322 TCCAAGTCCAAAGTCTCATCTGG + Intronic
1143029809 17:3961629-3961651 TGCAGGTGCACAGACTCCTGGGG + Intronic
1143672364 17:8405515-8405537 TGCATGAGCCCATCCTCATCTGG - Intergenic
1144192381 17:12858490-12858512 TTTAAGTCCACAGCCTTATCTGG + Intronic
1144670021 17:17127584-17127606 TGCAGGTGAACAGGCTCATTGGG + Intronic
1146547103 17:33749138-33749160 TGCAAGAGCACAGCTTCCTCTGG + Intronic
1146658231 17:34647885-34647907 TCCCAGTGCACAGCCCCTTCAGG - Intergenic
1147669186 17:42167008-42167030 TGCATGTTCACATCCTCATATGG + Intronic
1149102829 17:52927092-52927114 TGCAACTGCACAGTTCCATCTGG - Intergenic
1150905137 17:69328442-69328464 TGCAACTAGACAGTCTCATCTGG + Intergenic
1154092710 18:11379935-11379957 TGCAAGTCCACAGCACCTTCCGG - Intergenic
1156734602 18:40239174-40239196 TGCAATTTCAAAGCCCCATCTGG + Intergenic
1158859965 18:61582286-61582308 TGCCAGAGCTCAGACTCATCGGG + Intergenic
1159991018 18:74907545-74907567 TGGGAGAGCACAGCCTGATCAGG - Intronic
1160486834 18:79300627-79300649 TGCAAGTGCAGAGCTCCCTCTGG - Intronic
1162119597 19:8455113-8455135 TGCAAGTGCACCACCACACCTGG + Intronic
927693393 2:25223799-25223821 TACAACTGCACCGCCTCATAGGG + Intergenic
929270206 2:39963546-39963568 GGCATGTGCACAGCCTCACCAGG - Intergenic
930514776 2:52393149-52393171 TGCAAATCCAAAGTCTCATCTGG + Intergenic
932354486 2:71058066-71058088 TTAAAGTGCACAGCCTTAACTGG + Intergenic
935095097 2:99936533-99936555 TGTAAGTACACAGCCTCAAACGG - Intronic
937311515 2:120905983-120906005 TGGGACTGCACAGCCCCATCTGG - Intronic
939005263 2:136779777-136779799 TGCATGTGCACAGACCCATTTGG + Intronic
939306390 2:140416736-140416758 TTCAATTGCACAGCTGCATCTGG + Intronic
941169030 2:162115606-162115628 TGGAGCTGCACAGCCTCATGTGG + Intergenic
942340038 2:174934234-174934256 TGCAACTAGACAGTCTCATCTGG + Intronic
943657843 2:190528371-190528393 TGCCTTTGCACAGCCTCCTCGGG + Intronic
943818679 2:192290351-192290373 TGCAAGTAGACAGTCCCATCTGG + Intergenic
944222978 2:197320740-197320762 AGAGAGTGCAGAGCCTCATCAGG - Intergenic
944290772 2:198001948-198001970 TGCAACTACACAGTCCCATCTGG - Intronic
947287228 2:228530297-228530319 TGCAAGTAGACAGTCCCATCTGG - Intergenic
947929932 2:233956015-233956037 TGCAACTGGACAGTCTCATCTGG - Intronic
948868735 2:240787867-240787889 TGCAGCTTCACAGCCACATCTGG + Intronic
1168849835 20:968976-968998 TGCAAGTGTTCAGCTTAATCAGG - Intronic
1169148492 20:3270480-3270502 TTCAGCTGCAGAGCCTCATCAGG - Exonic
1171104084 20:22415827-22415849 TGCTACTGCACAGCTTCATGAGG - Intergenic
1173078131 20:39840175-39840197 TGCAAGTGGACAGCATCAGCTGG + Intergenic
1175322351 20:58098123-58098145 TGCAACTGCACAGACCAATCTGG + Intergenic
1175955657 20:62607854-62607876 TGCAGCTGGGCAGCCTCATCCGG - Intergenic
1176237405 20:64060037-64060059 CACAACTGCACAGCCTCCTCTGG + Intronic
1179470461 21:41606639-41606661 TGCAACGGCACAGTCTCAGCTGG - Intergenic
1179982495 21:44903605-44903627 TGCCAGTGCACAGCCCGCTCGGG - Intronic
1182975398 22:34619563-34619585 TGCAAGTGCAAACTCTTATCTGG + Intergenic
952817522 3:37458515-37458537 GGGAAGAGCACAGCCTCAGCTGG + Intronic
954479120 3:50781404-50781426 TACAGGTGCACAACATCATCAGG + Intronic
955204052 3:56879054-56879076 TGCAACTACACAGTCCCATCTGG - Intronic
955648495 3:61166926-61166948 TGCCATTGCAAAGCCTCAACAGG + Intronic
956958732 3:74373191-74373213 TGCAAGAGAAAAGCATCATCAGG - Intronic
960801735 3:121546696-121546718 TAGAACTGCACAGCCTCTTCAGG - Intergenic
968495146 4:911144-911166 TGTGGGTGCCCAGCCTCATCAGG - Intronic
973134920 4:46695460-46695482 TGCAACTGGACAGTCCCATCTGG + Intergenic
975962641 4:79931637-79931659 TGTAAGTGCACTGCGTTATCTGG - Intronic
978222276 4:106291117-106291139 TTCAAGTGTACAGCTGCATCTGG + Intronic
978838968 4:113186879-113186901 TGCAAGTGTAGAGCCTCATGTGG + Intronic
981152530 4:141395915-141395937 TGCAACTGGACAGTCCCATCTGG + Intergenic
985137807 4:186805549-186805571 TGCAAGTACTAAGCCTCTTCTGG - Intergenic
986789673 5:11147487-11147509 TGCAAGTCTCCAGCCTCATGTGG - Intronic
990922972 5:60988138-60988160 TGCAAGTGAAGAGCCGTATCAGG + Intronic
990997164 5:61744603-61744625 TGTAAGTGCACAGCCTATCCTGG + Intronic
995709576 5:115021308-115021330 TGCAACTAGACAGCCCCATCTGG + Intergenic
997196476 5:131983642-131983664 TCCAAGTGCACAGCCAGATGGGG + Intronic
997358858 5:133281693-133281715 TGCCAGTGCAGACCCTCAACTGG - Intronic
998784052 5:145689783-145689805 TGGAAGGGCACAGCCCAATCGGG + Intronic
1002199223 5:177517678-177517700 TGCAAGTACACAGATTCACCAGG + Intergenic
1003114438 6:3274032-3274054 TGTCAGTGCACAGCTTCATTTGG - Intronic
1003422782 6:5973528-5973550 TGCATGTGCACAGCCTCCAGAGG - Intergenic
1005597719 6:27395042-27395064 TCCAAGTCCAAAGTCTCATCTGG - Intronic
1006814941 6:36843722-36843744 TGCAAGGCCACAGCCTCCGCTGG + Intergenic
1007556219 6:42768721-42768743 TGTAAGTGCACGGCCTCAGAAGG - Intronic
1008681634 6:53878427-53878449 TGCAACTGGACAGTCCCATCTGG + Intronic
1014527572 6:122519286-122519308 TGCAACTAGACAGTCTCATCTGG - Intronic
1015765276 6:136709789-136709811 TACAGGTGCACACCATCATCTGG - Intronic
1018596297 6:165484741-165484763 TTCAATTGCACAGCTGCATCTGG + Intronic
1018664684 6:166124790-166124812 TTCAATTGCACAGCTGCATCTGG - Intergenic
1019032919 6:169028508-169028530 TGCAAGTGCAAAGTGTCACCTGG + Intergenic
1020187667 7:5971261-5971283 TGCAACTAGACAGCCCCATCTGG + Intergenic
1020295250 7:6753509-6753531 TGCAACTAGACAGCCCCATCTGG - Intergenic
1021392781 7:20114718-20114740 ACCAAGTGCACTGCCTCATTGGG + Intergenic
1021787254 7:24164450-24164472 TCCAAGTCCAAAGTCTCATCTGG - Intergenic
1023152645 7:37216302-37216324 TGAAAGAGCAAAACCTCATCAGG + Intronic
1023975832 7:45029107-45029129 CGCAACTGCACAGCCACATGAGG - Intronic
1025937659 7:66050065-66050087 TGCAACTAGACAGCCCCATCTGG + Intergenic
1026821933 7:73555869-73555891 TTAAAGTGCACAGCCTTATTTGG - Intronic
1029469681 7:100746448-100746470 GACAAGTCCACAGCCTCCTCAGG + Intronic
1029491007 7:100870024-100870046 TGCAACTGGACAGTCCCATCTGG + Intronic
1029683192 7:102126887-102126909 TGCAACTACACAGTCCCATCTGG + Intronic
1029961551 7:104693268-104693290 TCCAAGTCCATAGTCTCATCTGG - Intronic
1032238224 7:130142051-130142073 TGCAAGCACACAGGCTCTTCTGG + Intergenic
1033670252 7:143485676-143485698 TGCAAGTGCACTACCACACCCGG + Intergenic
1036287893 8:7460722-7460744 TGGAATTGCACAGCACCATCGGG + Intronic
1036333583 8:7850806-7850828 TGGAATTGCACAGCACCATCGGG - Intronic
1037933001 8:22894751-22894773 GTTAAGTTCACAGCCTCATCAGG + Intronic
1038691536 8:29768148-29768170 TGCAAATCCACACCCTCATGAGG + Intergenic
1040816486 8:51513234-51513256 TGCAAGTGCACAGCCTCATCTGG - Intronic
1041584486 8:59499896-59499918 TGAGAGTGCACACCCTCAGCAGG + Intergenic
1043156131 8:76782296-76782318 TGCTAGTACACAGCCACATGTGG + Intronic
1043238183 8:77896511-77896533 AGCAAGTGCACATTCTTATCAGG + Intergenic
1045436917 8:102173073-102173095 CCCAAGTTCACAGTCTCATCTGG + Intergenic
1045894802 8:107202268-107202290 TCCAAGTCCAAAGTCTCATCTGG + Intergenic
1048436675 8:134424723-134424745 CTCAAGGGCACAGCCTTATCTGG + Intergenic
1048918566 8:139207126-139207148 TGCACGTGCACCACCTCCTCTGG - Intergenic
1052090375 9:24320209-24320231 TCCAAGTACAAAGTCTCATCTGG + Intergenic
1052613805 9:30812178-30812200 TGCAACTGGACAGTCCCATCTGG - Intergenic
1053001446 9:34579080-34579102 TGCAAATGCACATCCGCATGGGG + Intronic
1053268155 9:36731017-36731039 GGTAAGTGCACAGTCTAATCTGG + Intergenic
1055657273 9:78463757-78463779 TGCAACTAGACAACCTCATCTGG + Intergenic
1056312267 9:85352598-85352620 TCCAAGTTCAAAGTCTCATCTGG + Intergenic
1056657523 9:88521558-88521580 TGCAAGTGCACTGGCTCAGTGGG - Intergenic
1056697658 9:88873733-88873755 GGCATGGTCACAGCCTCATCTGG + Intergenic
1056759640 9:89405438-89405460 TGGGGGTGCACATCCTCATCAGG + Exonic
1062246750 9:135572537-135572559 TGTAACTGCACAGCACCATCCGG - Intergenic
1062248476 9:135582563-135582585 TGCAAGTGGACGGTCCCATCTGG + Intergenic
1186050230 X:5584624-5584646 TGCAAGTAGACAGTCCCATCTGG + Intergenic
1186287612 X:8062607-8062629 TGCAACTGGACAGTCTCATCTGG - Intergenic
1190781068 X:53595375-53595397 AGCAAGTGCTCGGCCTAATCTGG + Exonic
1192369049 X:70498421-70498443 TGCCAGGACACAGCCTTATCAGG - Intronic
1195035202 X:100965829-100965851 TTCAAGTCCAAAGCCTCATCTGG - Intergenic
1197001932 X:121450271-121450293 GGCACATGCACAGCCTCATGAGG + Intergenic
1197626705 X:128810059-128810081 TGCAAGAGGATAGTCTCATCAGG - Intergenic
1198619241 X:138488285-138488307 TGCATGTTCTCAGCCTCAGCTGG + Intergenic