ID: 1040816493

View in Genome Browser
Species Human (GRCh38)
Location 8:51513267-51513289
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040816486_1040816493 10 Left 1040816486 8:51513234-51513256 CCAGATGAGGCTGTGCACTTGCA 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1040816493 8:51513267-51513289 CGGCATAAACACTCTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr