ID: 1040821132

View in Genome Browser
Species Human (GRCh38)
Location 8:51558978-51559000
Sequence ATGGATTAGTAGAGGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040821127_1040821132 5 Left 1040821127 8:51558950-51558972 CCCAATGAGTTCTGGGCTGGGGT No data
Right 1040821132 8:51558978-51559000 ATGGATTAGTAGAGGGAAAGAGG No data
1040821117_1040821132 21 Left 1040821117 8:51558934-51558956 CCCTCAAATTCTTCCCCCCAATG No data
Right 1040821132 8:51558978-51559000 ATGGATTAGTAGAGGGAAAGAGG No data
1040821128_1040821132 4 Left 1040821128 8:51558951-51558973 CCAATGAGTTCTGGGCTGGGGTT No data
Right 1040821132 8:51558978-51559000 ATGGATTAGTAGAGGGAAAGAGG No data
1040821125_1040821132 6 Left 1040821125 8:51558949-51558971 CCCCAATGAGTTCTGGGCTGGGG No data
Right 1040821132 8:51558978-51559000 ATGGATTAGTAGAGGGAAAGAGG No data
1040821121_1040821132 8 Left 1040821121 8:51558947-51558969 CCCCCCAATGAGTTCTGGGCTGG No data
Right 1040821132 8:51558978-51559000 ATGGATTAGTAGAGGGAAAGAGG No data
1040821123_1040821132 7 Left 1040821123 8:51558948-51558970 CCCCCAATGAGTTCTGGGCTGGG No data
Right 1040821132 8:51558978-51559000 ATGGATTAGTAGAGGGAAAGAGG No data
1040821118_1040821132 20 Left 1040821118 8:51558935-51558957 CCTCAAATTCTTCCCCCCAATGA No data
Right 1040821132 8:51558978-51559000 ATGGATTAGTAGAGGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040821132 Original CRISPR ATGGATTAGTAGAGGGAAAG AGG Intronic
No off target data available for this crispr